Information letter Dear colleagues! Faculty of Basic Medicine, Lomonosov Moscow State University and State Research Center ­ Institute for Biomedical Problems, Russian Academy of Science would like to invite you to participate in the work of the VII Russian National School with International Participation on Muscle and Exercise Physiology «New approaches to studying of classical problems». ... Abstracts of reports will be published. ... The receipt of your abstract will be confirmed by e-mail. ...

Еще в разделе: (Показать все результаты (>8) - www.fbm.msu.ru/ )

... Данный раздел информационного портала посвящен основным конференциям по тематике ПЛИС, проходящим как в мире, так и в России. FPGA 2010 - Eighteenth ACM/SIGDA International Symposium on Field-Programmable Gate Arrays. ReConFig'09 - 2009 International Conference on ReConFigurable Computing and FPGAs. ИКТМР-2009 . ... 2009 Symposium on Application Accelerators in High-Performance Computing (SAAHPC'09) . RAW 2009 . ... 5th International Workshop on Applied Reconfigurable Computing. ...

Еще в разделе: (Показать все результаты (>18) - fpga.parallel.ru/ )

• Источники информации по тематике ПЛИС
• Проект RAMP

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>4) - swx.sinp.msu.ru/ )

... If you have already registered, please fill in you login and password in the form below main menu (leftmost column). ... If something goes wrong (for example, you've been registered by site andministrator and don't have password at all or you just forgot it), please contact site administration by E-mail dubna2007@biophys.msu.ru . ... If you are warned that you've already registered please contact site administration by E-mail dubna2007@biophys.msu.ru to get access to your Personal Office . ...

Еще в разделе: (Показать все результаты (>53) - www.msm.biophys.msu.ru/ )

... Subject to the MOIP Charter both natural and legal persons may become the members of the Society upon paying admission fees and acknowledging the Charter and program documents. ... Persons may be elected as the Society?s full and corresponding members on a show of hands at the Society?s Council (Presidium) meeting if nominated by a section and recommended by at least two full Society?s members. ... The Society?s full members have the following rights: . ... 2015 Moscow Society of Naturalists . ...

Еще в разделе: (Показать все результаты (>4) - www.moip.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...

Еще в разделе: (Показать все результаты (>20) - observ.pereplet.ru/ )

• Observatory
• MASTER : List of HAZARDOUS ASTEROIDS (PHA) and COMETS discovered by MASTER

About BAFIZ . ... BAFIZ is a program devoted to the development of a distributed network of the knowledge and data bases for research of fundamental properties of the matter and applied nuclear physics. The project sponsored by Russian Foundation of Basic Research , RFBR reference number is 95-07-19502. ... This Page is developed at Laboratory of Computational Mathematics, . ... Last updated on 2 September 1999 . Copyright 1999 Laboratory of Computational Mathematics (DRCM) ...

Еще в разделе: (Показать все результаты (>10) - dbserv.sinp.msu.ru/ )

. HOME . ABOUT . RESEARCH . NEWS . PUBLICATIONS . DATA . COLLABORATION . OUTREACH . CONTACT US . news . Panasyuk M. (SINP, Russia). Relec . Klimov S. (ISR, Russia). Wave Research... (SINP, Russia). Relec 1th results . Bogomolov V., Iudin A. (SINP, Russia). Relec TGF-GRB . Bogomolov A., Myagkova I. (SINP, Russia). Hi-energy electrons research...

Еще в разделе: (Показать все результаты (>8) - vernov-relec.sinp.msu.ru/ )

... if (B1) { S1; } if (B1) { S1; } if (B2) { S2; } - - ...exp... int x = 1; if (x == 1) { std::cout << "Okay" << std::endl; } else { std::cout << "Error" << std::endl; } -- ­ int strlen(const char* p) { int len = 0; do { ++len; } while (*p++); return len; } «», «bbb» -- , : · ­ , , · ­ , , · ­ , · ­ . ... 1977 ­ LTL, · , 1981 ­ (CTL), · , , 1981 , , 1982 ­ model checking ( ), · , 1986 ­ model checking ( ), · , 1989 ­ SPIN. ... The Spin Model Checker: Primer and Reference Manual, Addison Wesley, 2003. ...

Еще в разделе: (Показать все результаты (>2) - savenkov.lvk.cs.msu.su/ )

SVETKA, a program for analysis of different alignments . Back to the help page . ... Such a feature can look like " Leucine in the position 362 of the alignment of the entire family " and can, in many cases, be a "decision rule" to distinguish sequences from two sides of a tree branch. ... Comparing the alignment with an input tree (the tree may be entered by the user or reconstructed with the WPGMA algorithm), the program detects supporting positions of the alignment for every branch the tree. ...

Еще в разделе: (Показать все результаты (>774) - monkey.belozersky.msu.ru/ )

• S publications
• ETS numeration assumed
• SCOP classification

HOW DOES CRYSTAL CHEMISTRY PREDICT STRUCTURE AND PROPERTIES OF CRYSTALS V. S. URUSOV Crystal chemistry has created a set of methods and procedures to predict structure and properties of crystals. ... З. л. мкмлйЗ еУТНУ,ТНЛИ ,,УТЫ ТЪ,ВММњИ ЫМЛ,В ТЛЪВЪ ЛП. е.З. гУПУМУТУ, ї м ЫТУ, З.л., 1997 . ... мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм.. ... 1 мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм а лЗйвлнЗД дкалнДггйЗ 43 . ... Ti4+ 2 -, 1 : 2 , . 2 --2 - Ti4+-Ti4+) , (2 --Ti4+). ...

Еще в разделе: (Показать все результаты (>33) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/en/
• http://cryst.geol.msu.ru/staff/elbel.php
• http://cryst.geol.msu.ru/staff/CV22.pdf

... Новости . ... Абитуриентам . ... Главная Новости Наука . Компания Stanford Equipment Co (InterMedica) - официальный дистрибьютер Stanford Research Systems приглашает Вас к сотрудничеству и предлагает широкий спектр исследовательского оборудования SRS и спектрометрических систем Ocean Optics. ... Новости сайта . ...

Еще в разделе: (Показать все результаты (>5) - www.dubinushka.ru/ )

A.Nekipelov Modernization of Basic Research in Russia: Russian Academy of Sciences ( RAS ) Vision Joint Session of Russian Academy of Sciences, Institute of France Academy of Sciences and Academy of Technology of France Paris, 2010, September 28 1 RAS in Russian Basic Science Potential (per cent, 2008) Russian Federation Research Organizations 100,0 RAS 12,7 Overall Personnel ... Who is the main actor in research: an institute or a laboratory? ...

Еще в разделе: (Показать все результаты (>25) - www.mse-msu.ru/ )

... International Relations in Context of Global Processes - 17| ... GLOBAL ECONOMIC AND POLITICAL TRENDS Prof. Olga Y. Kornienko Economic literature survey Week 1 (4 academic hours ) 1) Current trends of global economy Week 2 (4 academic hours ) 2) Migration, population and globalization Week 3 (4 academic hours ) 3) Corporate culture and management: new trends Week 4 (4 academic hours ) 4) Development markets in global environment Week 5 (4 academic ... Models of the global world. ...

Еще в разделе: (Показать все результаты (>108) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-1.pdf
• http://fgp.msu.ru/wp-content/uploads/2014/03/Information-Sheet.pdf

... Новости . ... О кафедре . ... Занятия в среду 7.11.2012 по Современным компьютерным технологиям (преподаватель Краев А.В.) на первой паре не состоится и переносится в связи с календарным отпуском преподавателя. ... Автор: Краев Андрей Владимирович 06.11.2012 . ... Будут заслушены доклады Аристова А.И., Карамышевой Т.В., Краева А.В., Будановой А.В. Автор: Фурсов Андрей Серафимович 27.10.2012 . ... Colin Angle - основателя и руководителя компании iRobot, крупного специалиста в области робототехники. ...

Еще в разделе: (Показать все результаты (>10) - ndsipu.cmc.msu.ru/ )

The Ecological Cooperation Project is the first large-scale children's network project in Russia. This project was founded on the principles of development and achievement of widespread nature awareness among Russian school children through the establishment and unification of numerous childrenтАЩs ecological projects. ... Nature Protected Areas . ... The Project is open for cooperative learning, and any childrenтАЩs ecological organization or group is welcome to participate. ...

Еще в разделе: (Показать все результаты (>16) - www.ecocoop.ru/ )

... Драйверы . ... Базовое ПО . ... Базовые тесты . ... URL: . Status: . Драйверы SCI от Dolphin оттестированы на кластере МГУ . Драйверы SCI от Scali оттестированы на кластере НИЦЭВТ . Todo: . Сделать RPM/SRPM пакет mpich-sci . People: . НИЦЭВТ . ... http://www.mpi.nd.edu/lam . ... Протестирован на слабосвязном кластере МГИУ . ... http://www.epm.ornl.gov/pvm . ... http://www.netlib.org/pvm3/xpvm/index.html . ...

Еще в разделе: (Показать все результаты (>6) - cluster.msu.ru/ )

• Интернет

... 2015 . ... Submit your article . ... Since the collapse of the Soviet Union and the end of the Cold War, there has been a string of small wars that have been fought on humanitarian grounds . The reasoning and the propaganda that paves the way by cultivating public opinion to accept these wars has been developed over a number of decades in countries deemed to be democratic in nature. ... Humanitarian war, western intervention, propaganda, information war, democracy. ... Public Administrarion". ...

Еще в разделе: (Показать все результаты (>179) - ee-journal.spa.msu.ru/ )

... Main fields of study for the qualification and specialization . ... Bachelor Integrated Programme . ... Name of qualification (degree): BACHELOR . Field of study: 04.03.02 Materials Chemistry, Physics and Mechanics . Official length of full-time programme: 4 years . ... Name of qualification (degree): MASTER . ... Name of qualification (degree): . RESEARCHER, ACADEMIC RESEARCHER . Field of study: 02.00.01 Inorganic chemistry . ... Field of study: 02.00.21 Solid state chemistry . ...

Еще в разделе: (Показать все результаты (>4) - www.fnm.msu.ru/ )