... My field of specialization is Stability Theory, Nonlinear Dynamics, Asymptotic Methods, Mechanics of Solids, System Identification, Optimal Control, Economic Growth. ... A.O. Belyakov and A.P. Seyranian (2012). ... A.O. Belyakov and A.P. Seyranian, . ... A.P. Seyranian and A.O. Belyakov, Swing dynamics. ... A.O. Belyakov, A.P. Seyranian, and A. Luongo, Regular and chaotic dynamics of the swing. 6th EUROMECH Nonlinear Dynamics Conference (ENOC 2008) , Saint Petersburg, Russia, June, 30 - July, 4 2008...

Еще в разделе: (Показать все результаты (>10) - belyakov.imec.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• ConClus

Ministere de l'educat ion nat ionale, de l'enseignement superieur et de la , recherche . ... It is also strange, to say the least, that such has been levied only now, years after the publishing o f the another proof of dishonest y and disinformat ion of their author. another proof count. This is an accusatio n book. ... 2006) - . ... It is the very contrary and to say the least quite an achievement in the Russia n academic landscape where inst itutions have been for so long a "black spot". ...

Еще в разделе: (Показать все результаты (>19) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/files/k1205.pdf
• http://www.mse-msu.ru/Bassanini_Mosca_rev4.pdf
• http://www.mse-msu.ru/Nekipelov_comment_on_reserve.pdf

... In the 1970s, George Ritzer transformed Kuhnian paradigm into a consolidativeimaginary paradigm and suggested multi-paradigmatic model of sociology. ... N.Y., 1972; Levine D. Visions of the sociological theory. ... 4 Kuhn T. The structure of scientific revolutions. ... 6 Ritzer G. Sociology: a multiple paradigm science. ... Cambridge, 1970. ... On theoretical sociology" (N.Y., 1957) "Paradigms: codification of sociological theory" "On social structure and science" (Chicago, 1996), "" "" "". . ...

Еще в разделе: (Показать все результаты (>34) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2012/1/11.pdf

... Кафедра математического моделирования и информатики . ... Добро пожаловать на сайт кафедры математического моделирования и информатики , заведующий кафедрой ? ... студент младших курсов и хотите делать у нас курсовую или поступать к нам, ознакомьтесь с основными направлениями деятельности кафедры и предлагаемыми темами курсовых работ. Может быть, вам нужны материалы по программированию , теории вероятностей , специальным курсам или математическим дисциплинам по выбору . ... Программирование . ...

Еще в разделе: (Показать все результаты (>6) - cmp.phys.msu.ru/ )

• Welcome! | Chair of Computer Methods of Physics
• User account | Chair of Computer Methods of Physics
• Contacts | Chair of Computer Methods of Physics

... О кафедре . ... Завершился курс "Методы лабораторных зоологических исследований", впервые проводимый в этом году. ... 11-й Морской семинар! Продолжить чтение . 31 марта 2016 (четверг), 13:00, 594 ауд. - заседание кафедры . ... Десятый семинар центра морских исследований МГУ . ... Девятый семинар центра морских исследований МГУ . ... JavaScript must be enabled in order for you to use Google Maps. However, it seems JavaScript is either disabled or not supported by your browser. ...

Еще в разделе: (Показать все результаты (>3) - invert.bio.msu.ru/ )

• История кафедры
• Учебный процесс

... For impatient users: You can download RusTeX in three different ways (Full installation; Selective download; Diskette-ready minimal installation) --- so at least read explanations about these methods before you download something. Please, use "Save link as" (right mouse button) for downloading files, otherwise .arj files and other binary files will be corrupted. ... TeX files are compact and readable in any text viewer: just text and commands for formatting and commands for equations drawing. ...

Еще в разделе: (Показать все результаты (>4) - tex.bog.msu.ru/ )

Space Weather . ... Models . Data . ... Space Weather Analysis Centre of SINP MSU provides information about the current state of near-Earth's space. Information Services ( SWX ) on the website of the center provide access to current data describing the level of solar activity, geomagnetic and radiation state of the magnetosphere and the heliosphere in the real time. For data analysis, the models of the space environment, working in off-line as well as on-line mode have been implemented. ...

Еще в разделе: (Показать все результаты (>5) - swx.sinp.msu.ru/ )

... It operates with high efficiency inside a 1 T magnet in an intense charged particle beam of up to 3 в 106 particles/s. It uses a unique light collection system combining air space, wavelength shifter disc and conventional lucite light guides. ... Description of the counter The final CPVA counter is composed of a plastic scintillator, an air light guide, a wavelength shifter disc, lucite wave guides and two phototubes; their configuration and dimensions are given below. ... Optics of the CPVA counter...

Еще в разделе: (Показать все результаты (>35) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/~sergant/CV.txt
• http://lav01.sinp.msu.ru/nir/papers/NIM_Cyl-Drift-Ch.pdf
• http://lav01.sinp.msu.ru/nir/papers/IEEE_ASC_17_2_2007_1185_1190.pdf

... О кафедре . ... КРИВОНОЖКО Владимир Егорович (11.06.1948, г. Москва) д.физ.-мат.н., профессор МФТИ, зав. кафедры АСУ МИСИС. ... Krivonozhko V. E., F rsund F. R. Lychev A. V. Terminal units in DEA: Definition and Determination // University of Oslo. ... F rsund F. R., Krivonozhko V. E., Lychev A. V. Hidden Effects in DEA Models //Differential Equations. ... Krivonozhko V. E., F rsund F. R., Lychev A. V. Some Ulterior Effects in the DEA models // Abstracts of the INFORMS Annual Meeting. ...

Еще в разделе: (Показать все результаты (>9) - ndsipu.cmc.msu.ru/ )

• Новости | Кафедра НДСиПУ

Draft Dr. Paul Twomey President and Chief Executive Officer Internet Corporation for Assigned Names and Numbers (ICANN) Speech to Third International Forum Partnership Among State, Business Community and Civil Society in Ensuring Information Security Garmisch-Partenkirchen, Germany Monday, 20 April 2009 Dear Vladislav Petrovich, Dear Alexei Anatolievich, Distinguished guests, Ladies and Gentlemen. ... ICANN itself is evolving, mirroring the changing nature of the global Internet community. ...

Еще в разделе: (Показать все результаты (>12) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/bayern2009/perl.doc
• http://www.iisi.msu.ru/UserFiles/File/bayern2009/gorokhov_eng.doc
• http://www.iisi.msu.ru/UserFiles/File/bayern2009/malisevic.doc

... The factors that play the key role in complex formation are as follows: the rate of protein diffusion to the docking site; long-range electrostatic interactions between protein surfaces, geometric and chemical complementarity of binding areas; molecular mobility at the proteinґprotein interphase, hydrogen bonds, Van der Waals interactions, hydrophobic interactions, and salt bridges. ... Three-dimensional protein molecules are constructed on the basis of data extracted from the Protein Data Bank. ...

Еще в разделе: (Показать все результаты (>14) - www.library.biophys.msu.ru/ )

... Institute of Mechanics . ... In 1977- 1991 A .P.Seyranian was a Member of Scientific Staff at the Institute of Problems in Mechanics of the Academy of Sciences in Moscow . ... Since 1993 A .P.Seyranian is a Leading Researcher and Professor of the Institute of Mechanics , Moscow State Lomonosov University . ... In 2003 he became an Invited Speaker and Chairman of the Session 'Stability and Control Problems in Mechanics' at the conference 'Physics and Control 2003' , Sankt-Petersburg. ...

Еще в разделе: (Показать все результаты (>3) - seyranian.imec.msu.ru/ )

Проект Ломоносов . ... М.В. Ломоносов . ... Это будет более крупным космическим проектом МГУ по сравнению с предыдущими спутниками ?Татьяна? и ?Татьяна-2?. ... МГУ носит имя М.В.Ломоносова . Поэтому имя М.В.Ломоносова ?на борту? спутника ? ... Зарисовка из книги М.В. Ломоносова. Запуск спутника ?Михайло Ломоносов? безусловно внесет значительный вклад в развитие человеческого знания в область физики, исследования которые начал еще М.В. Ломоносов (исследования природы молний и т.д.). ...

Еще в разделе: (Показать все результаты (>62) - lomonosov.sinp.msu.ru/ )

... A p P EC Astropar ticle Physics for Europe Ї Cosmic rays: A large array for the detection of charged cosmic rays ( Auger North) Ї Gamma rays: A large array of Cherenkov Telescopes for detection of cosmic high energy gamma-rays ( CTA ) Ї High energy neutrinos: A cubic kilometre-scale neutrino telescope in the Mediterranean (KM3NeT) Ї Dark matter search: Ton-scale detectors ... A p P EC Astropar ticle Physics for Europe Ї Cosmic rays: ґ ґ ґ ґ ґ AMS detector launched. ...

Еще в разделе: (Показать все результаты (>5) - tunka.sinp.msu.ru/ )

• http://tunka.sinp.msu.ru/en/presentation/horns_vhe.pdf

Curriculum Vitae . ... Lomonosov Moscow State University , Faculty of Computational Mathematics and Cybernetics . ... Lomonosov Moscow State University , Faculty of Physics . ... 2010 - till now . ... Research Scholar . ... Scholarship supporting perspective young scientists and teachers of Lomonosov Moscow State University who achieved significant results in teaching and research . ... Kurchatov Scholarship for excellent students of the Faculty of Physics, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>5) - oc.cs.msu.ru/ )

Moscow State University Belozersky Institute of Physico-Chemical Biology . Department of Electron Microscopy is a sub-division of A.N. Belozersky Institute of Physico-Chemical Biology . ... We are interested of how eukaryotic cell is organized, formed and functioned. Since A.N. Belozersky Institute of Physico-Chemical Biology is one of the scientific departments of Moscow State University ? ... Understanding the metaphase chromosome architecture remains a basic challenge in cell biology. ...

Еще в разделе: (Показать все результаты (>2) - cellbiol.genebee.msu.ru/ )

... Web portal on atmospheric environment is developed by international consortium as a be-lingual information resource in area of atmospheric physics and chemistry and in related domain air quality assessment and management. ... The portal has all typical component and services like collections of links, user group registration, discussion forum, etc. ... Each scientific site is an information-computational system designed in Internet technologies. ... 00189 138. ... 2003 . ... 2002, 252 . ...

Еще в разделе: (Показать все результаты (>5) - geophys.srcc.msu.ru/ )