... He distributes these gifts in sacks (each sack can contain from 1 to n items) and puts the sacks with gifts around the Christmas tree (only the content of the sacks and their ordering on the circle around the tree are important). ... A river falling into a sea forms a delta which is a system of branches consisting of channels without inner intersections. (a) Suppose that in a given delta there are exactly n different (i.e. differing by at least one channel) routes down the stream. ...

Еще в разделе: (Показать все результаты (>2) - www.universe.msu.ru/ )

... Winner of joint DAAD (German Academic Exchange Service) and Moscow State University Scholarships Program ?Vladimir Vernadskii? for joint research in Germany. 2011-present. ... 16.11-12.12.2009, Collaborative Research Center 701 of Bielefeld University, Bielefeld, Germany. ... Another ham sandwich in the plane? (joint work with Alexey Balitskiy and Roman Karasev from Moscow Insitute of Physics and Technology), November 9, 2013, Kolloquium Kombinatorik, TU Ilmenau, Ilmenau, Germany. ...

Еще в разделе: (Показать все результаты (>145) - higeom.math.msu.su/ )

• Publications (English)
• S.P.Novikov Seminar
• Publications (Russian)

... Scaliger sometimes forgot as anyone will when doing chronological computations whether he sought a current or a completed year, and therefore gave Julian dates that did not actually match the cyclical dates his computations had determined (e.g. eras 37,42, and 49). ... This table lists all the eras explicitly given as such by Scaliger, with their positions in the Julian Period and their dates in years BC or AD. ... To find a year in this era, subtract 296 from the date in the era of the Hegira. ...

Еще в разделе: (Показать все результаты (>135) - hbar.phys.msu.ru/ )

• R.R.Newton, "Astronomical evidence..."

Communicating Through Art, L.Vershbow . ... But here I am, and as a designer, I will attempt to explain to you how I perceive art and design as a form of communication. Most of us think of art as the works that hang in museums and on the walls of our homes. ... But art, design and symbols, whether they are aesthetically pleasing or not, are all around us, and they help to guide us through the complexities of everyday society. ... Today I am a designer and creator of contemporary jewelry. ...

Еще в разделе: (Показать все результаты (>17) - suny.msu.ru/ )

• Center on Russia and the United States :: Publications

... Download NPG-explorer . ... Build nucleotide pangenome . ... Here we provide a table for 3 Brucella genomes: all: embl :CP002459 BRUMM chr1 c Brucella melitensis M28 chromosome 1 all: embl :CP002460 BRUMM chr2 c Brucella melitensis M28 chromosome 2 all: embl :CP003176 BRUAO chr1 c Brucella abortus A13334 chromosome 1 all: embl :CP003177 BRUAO chr2 c Brucella abortus A13334 chromosome 2 all: embl :CP002078 BRUPB chr1 c Brucella pinnipedialis B2/94 chromosome 1 all: ... Fix bugs....

Еще в разделе: (Показать все результаты (>11) - mouse.belozersky.msu.ru/ )

• Geometrical core

4 SPIN. ... 0 1 Hello, world! ( ) ";" , active proctype main() { printf("Hello, world!\n") } ­ , >spin hello.pml Hello, world! 1 process created Hello, world! ... mtype = { P, C }; mtype turn = P; active proctype producer() { do :: ( turn == P) - printf( Produce\n ); turn = C od } active proctype consumer() { do :: ( turn == C) - printf( Consume\n ); turn = P od } ( 1) ­ 0, (op on sequence) (guard) ­ mtype = { P, C }; mtype turn = P; active proctype producer() { do :: ( ...

Еще в разделе: (Показать все результаты (>3) - savenkov.lvk.cs.msu.su/ )

• http://savenkov.lvk.cs.msu.su/mc/lect02.pdf

... Cancellation policy for all excursions: The cancellation of the tours before May 22, 2013 - no penalty. ... Time : will be announced soon . The price includes : transfer Moscow-Suzdal-Moscow, 1 night accommodation, meals according to the program, entrance tickets, English speaking guide. Suzdal is a calm old Russian town situated 220 km north-east of Moscow, 38 kilometers north from the city Vladimir, on the Kamenka river. ... Tour program: . ... Excursion to State Tretyakov Gallery . ...

Еще в разделе: (Показать все результаты (>6) - iconolat13.phys.msu.ru/ )

• Invited speakers
• Symposia

... The colleges had gathered a lot of experience in upbringing of young people. ... Keywords: historical anthropology, cultural history, daily city life, women's education, modernisation, school medicine, empress Maria's establishments, closed girls' colleges Strokina A.N., Butareva I.I. Ergonomics measurements of body schoolchildren (p. 30) The article presents the children's body size, intended for the construction of facilities and activities for communities associated with their use of spaces. ...

Еще в разделе: (Показать все результаты (>27) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2014_2.doc
• http://www.antropos.msu.ru/vestnic/e2013_1.doc
• НИИ и Музей антропологии | Вестник Московского университета. Серия XXIII.

... Phys. 48 (2000) 5 ± 7, 637 ± 641 ± ± Generation of Entanglement in a System of Two Dipole-Interacting Atoms by Means of Laser Pulses I. V. Bargatin, B. A. Grishanin, and V. N. Zadkov International Laser Center and Department of Physics, M. V. Lomonosov Moscow State University, Moscow 119899, Russia Abstract Effectiveness of using laser field to produce entanglement between two dipole-interacting identical twolevel atoms is considered in detail. ... 6] R. G. Brewer, Phys. Rev. A 52 (1995) 2965. ...

Еще в разделе: (Показать все результаты (>96) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/PRA22309.pdf
• http://qilab.phys.msu.ru/papers/PRA-2000-61-52305-en.pdf
• Quantum Information Lab, Int'l Laser Ctr. and Faculty of Physics, M.V.Lomonosov

... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

• SAI OCL Catalog Description
• SAI OCL Catalog Publications
• SAI Open Star Clusters (SAI OCL) Catalog

Publications of O. Senko . ... Publications of Group . ... Chemical Enzymology Department, Chemical Faculty . The M.V. Lomonosov Moscow State University, Lenin's Hills, 1/11 Moscow 119992, Russia . ... 7 (495) 939-31-70, Fax: +7 (495) 939-31-70, +7 (495) 939-54-17 . ... Master's Degree, Moscow State Academy of Fine Chemical Technology, (2005) . ... Bachelor of economy, Moscow State Academy of Fine Chemical Technology, (2004) . ... Publications: . Number of Patents and Patent Proposals: 1 . ...

Еще в разделе: (Показать все результаты (>143) - www.enzyme.chem.msu.ru/ )

... Smurova KM, Alieva IB, Vorob'ev IA. Free and centrosome-attached microtubules: quantitative analysis and themodeling of two-component system. ... Genes Cells. ... Mimori-Kiyosue Y, Grigoriev I, Lansbergen G, Sasaki H, Matsui C, Severin F, Galjart N, Grosveld F, Vorobjev I, Tsukita S, Akhmanova A. CLASP1 and CLASP2 bind to EB1 and regulate microtubule plus-end dynamics at the cell cortex. J Cell Biol. ... Cell Biol Int. 2004;28(2):139-50. ... Membr Cell Biol. 1997;11(2):195-211. in Russian . ...

Еще в разделе: (Показать все результаты (>40) - cellmotility.genebee.msu.ru/ )

• publications2

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>2) - npidb.belozersky.msu.ru/ )

Welcome to Fourmilab 's calendar converter! ... In the Julian calendar every fourth year is a leap year in which February has 29, not 28 days, but in the Gregorian, years divisible by 100 are not leap years unless they are also divisible by 400. ... The average length of a year is 365.2468 days compared to the actual solar tropical year (time from equinox to equinox) of 365.24219 days, so the calendar accumulates one day of error with respect to the solar year every 216 years. ... Excel serial day: . ...

Еще в разделе: (Показать все результаты (>17) - sbmg.geol.msu.ru/ )

• Ф-502

Here is a list of previous events held by our Department. April 23, 2012 . Round Table Repeated Speech: Between a Commonplace and an Artistic Experiment held as a part of the Lomonosov Readings conference. ... Lecture Language, Culture and Hegemony: Rethinking the Politics of Culture in the єбє¬ntext of the Russian Revolution . ... Round Table . ... November 30, 2011 . ... Round Table Reading a Monument: A Memorial Place in the City (held as a part of the conference Polyphony of the City ). ...

Еще в разделе: (Показать все результаты (>11) - discours.philol.msu.ru/ )

• Publications
• Summer School 2016
• Tatiana Venediktova

Synthesis and Use of Humic Derivatives Covalently Bound to Silica Gel for Np(V) Sequestration I.V. Perminova , L.A. Karpiouk, N.S. Shcherbina*, S.A. Ponomarenko§, St.N. Kalmykov, and K. Hatfield Department of Chemistry, Lomonosov Moscow State University, Moscow 119992, Russia Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow 119991, Russia § Institute of Synthetic Polymer ... I.V. Perminova, et al. ...

Еще в разделе: (Показать все результаты (>165) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2008/2008-kholodov-retention.pdf
• MGUMUS -- Vladimir A. Kholodov
• MGUMUS -- Researches

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• ConClus

ВМиК-Online! ... Факультет . ... Абитуриенты . ... Вариант письменного вступительного экзамена . по английскому языку . Отделение бакалавров факультета ВМиК . ... They found that cannabis users are 40 percent less effective in fighting viruses than normal people. ... Группа В Контакте для абитуриентов ВМК МГУ: . Поступление на ВМК МГУ 2012 . Форум абитуриентов ВМК МГУ . ... Телефон приемной комиссии факультета ВМиК МГУ: . ... 2001 2012 ВМиК Online! ...

Еще в разделе: (Показать все результаты (>5) - www.cmc-online.ru/ )