Научно-образовательный центр Геномного секвенирования МГУ . ... Sep 11, 2014, 9:17 AM . Yegor Bazykin attached NGS_supported_list.pdf to Результаты конкурса NGS-проектов . ... Yegor Bazykin deleted attachment NGS_supported_list.pdf from Результаты конкурса NGS-проектов . ... Yegor Bazykin edited Конкурс NGS-проектов . ... Yegor Bazykin created Результаты конкурса NGS-проектов . Jul 5, 2014, 2:53 AM . Yegor Bazykin updated polozhenie.pdf . ... Recent Site Activity | ...
... Carbamide . ... Moscowљ? ... URALCHEM and Stamicarbon will develop a new technology for urea production . URALCHEM, a leading Russian producer of nitrogen fertilizers, signed a joint technology development agreement for the synthesis of urea with Stamicarbon, the world's top developer and licensor of urea processes. ... Laboratory of Chemical Thermodynamics љwasљestablished by Prof. Adam V. Rakovsky (corresponding member of USSR Academy of Sciences) first as a "halurgy laboratory" in 1930. ...
... The S.P.Novikov Seminar came into being in the mid-sixties. ... 1] L.A.Alaniya, On manifolds of the Alexander type// Uspekhi Mat. Nauk, V. 46 ,1991, P. 179-180. ... Nauk SSSR, V.43, 1979, P. 104-240. ... 11] V.M.Bukhshtaber, A.S.Mishchenko, S.P.Novikov, Formal groups and their role in the apparatus of algebraic topology// Uspekhi Mat. ... Some applications to differential topology and to the theory of characteristic classes// Izv.Akad.Nauk SSSR, V. 34, 1970 I N2, P. 253-288; II: N3, P. 475-500. ...
THE 75th NAME-LIST OF VARIABLE STARS. ... The 75th Name-List consists of two tables. ... the literature, taken from positional catalogues, including USNO A1.0/A2.0 and GSC, or determined by the authors); the range of variability (sometimes the column Min gives, in parentheses, the amplitude of light variation; the symbol ( means that the star , in minimum light, becomes fainter, than the magnitude indicated); and the system of magnitudes used ( P are photographic ...
VARIABLE STARS, THE GALACTIC HALO AND GALAXY FORMATION C. Sterken, N. Samus and L. Szabados (Eds.) 2010 Formation Mechanisms for Spheroidal Stellar Systems O. K. Sil'chenko 1 Sternberg Astronomical Institute of the Moscow State University, Moscow, Russia Abstract. Spheroidal stellar systems on various scales include elliptical galaxies, dwarf spheroidal galaxies, and globular stellar clusters. ... The formation mechanisms of the oldest globular clusters represent a puzzle yet. ... 2009). ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Dear creators of the Bensons courses! First of all I would like to thank you for such a magnificent English course! ... Look, it's really much more interesting - to listen to a virtual book, to look through the pictures, let alone role-play! ... However, I'm very glad that I took up "Bensons" - the course has given me wonderful possibilities to learn more about English culture, to fill some gaps in my knowledge of English grammar and just to spend my time with great pleasure and benefit! ...
RAPID COMMUNICATIONS PHYSICAL REVIEW A, VOLUME 62, 011802 R High-intensity pulsed source of space-time and polarization double-entangled photon pairs Yoon-Ho Kim,* Sergei P. Kulik, and Yanhua Shih Department of Physics, University of Maryland, Baltimore County, Baltimore, Maryland 21250 Received 4 April 2000; published 13 June 2000 Two spatially separated type-I nonlinear ... Two orthogonally oriented type-I BBO crystals are placed collinearly and pumped by 45° polarized femtosecond pulses. ...
... Scientific educational events were organized at the Chair and the Faculty in the framework of the All-Russian School RESEARCH AND EDUCATIONAL PROJECTS on Global Social and Natural Processes in Interdisciplinary AND ACTIVITIES Studies as a joint action with the MSU Youth Council on Federal Task Program aimed at the inclusion of young Scientific research studies done by students of people in the scientific educational innovation processes the Chair and the Faculty were praised at the in Russia. ...
[
Текст
]
Ссылки http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-2.pdf -- 1261.4 Кб -- 13.09.2014 Похожие документы
MOSCOW STATE UNIVERSITY -- Faculty of Biology -- Department of Human Physiology -- . ... Our interest is the secret springs of work of a brain. How can a new idea be born in the brain if the physical environment remains constant? ... What mechanisms of the brain are broken in schizophrenia? ... For this purpose we create brain-computer interfaces (BCI) based on modern methods of computational electroencephalography. ... Department of Human Physiology . ... Former Visitors . ... Former students . ...
... MATHEMATICAL AND SYSTEM BIOLOGY UDC 577.1 Membrane Profile-Based Probabilistic Method for Predicting Transmembrane Segments via Multiple Protein Sequence Alignment R. A. Sutormina and A. A. Mironova a b , b, c State Research Center GosNIIgenetika, Moscow, 117545 Russia; e-mail: sutor_ra@mail ... Bioinformatics, Moscow State University, Moscow, 119992 Russia Received January 25, 2006 Abstract--Prediction of transmembrane (TM) segments of amino ... Protein Sci. ... Proteins. ...
[
Текст
]
Ссылки http://storage.bioinf.fbb.msu.ru/~roman/mol_biol_mosk_2006.pdf -- 151.6 Кб -- 25.05.2006 Похожие документы
... Only by numerical simulation. ... moment T (K) Dipole moment (D) Experiment Other example: Diffusion constant 200 250 298 350 400 2.40 2.37 2.48 2.59 2.80 2.25 The Distribution functions: radial distribution function 1 g (r) = N t =1 j i N TS N pair ( r - rij ) The Distribution functions: radial distribution function CC def 2 Work mode computer related 1) · Perform simulation , create trajectory file · Calculate properties timestep by timestep 2) · Perform ...
... Keywords: anthropology, craniotrigonometry, skull angular morphometry, the Russian Imperial Romanov family, shaping angles parameters Sviridov A.A. Cranial study of population of Loyalty Islands (Melanesia) (p. 88) The aim of this work is to study cranial series of 67 skulls from the Loyalty Islands (Northern Melanesia), stored at Musee de l'Homme (Paris, France). ... The study of intragroup variability showed a difference in the cranial types of the population of the Lifou and Mare islands. ...
[
Текст
]
Ссылки http://www.antropos.msu.ru/vestnic/e2014_2.doc -- 71.0 Кб -- 23.07.2015
[
Текст
]
Ссылки http://www.anthropos.msu.ru/vestnic/e2014_2.doc -- 71.0 Кб -- 23.07.2015 Похожие документы
Annu. ... Key Words stellar energy production, Nobel Prize, supernova, binary pairs s Abstract Astrophysics has been an important part of my personal and scientific life three times. ... Gamov suggested to one of his graduate students, Charles Critchfield, that he actually calculate the proton-proton reaction. ... In stars, the proton-proton reaction is usually followed by a chain of reactions with the end result of producing 4He. ... In 1938, they suggested energy production in stars. ...
Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...
... General Information . ... For physics faculty . ... Until 1939 in Moscow State University there was one undivided General Physics Chair. ... He was a leading scientist in the field of magnetic phenomena, and during 14 years the experimental and theoretical research of condensed matter magnetization, magnetic hysteresis and ferromagnetic resonance have been conducted under his leadership. ... In 2003 the Chair was renamed to Chair of General Physics and Magneto-Ordered Matter. ...
О НЕУСТОЙЧИВОСТИ СХОДЯЩИХСЯ УДАРНЫХ ВОЛН ПОЛИГОНАЛЬНОЙ ФОРМЫ А.В. Конюхов, А.П. Лихачев Объединенный институт высоких температур РАН, Москва Как известно [1], сходящиеся цилиндрические (сферические) ударные волны неустойчивы по отношению к потере пространственной симметрии с тенденцией к возникновению полигональной (полиэдральной) формы. ... Whitham, G. B., 1974 Linear and Non-linear Waves. ... Schwendeman, D. W., Whitham, G. B. On converging shock waves // Proc. R. Soc. ...
[
Текст
]
Ссылки http://hit-conf.imec.msu.ru/2012/abstracts/AbstractKonyukhovLikhachev.doc -- 263.5 Кб -- 14.06.2015 Похожие документы
Международный учебно-научный лазерный центр МГУ им. М.В. Ломоносова . ... О МЛЦ МГУ . ... Абстракт: The current status of studies in the physics of entangled states of atomic systems Р an interdisciplinary field involving quantum optics, quantum information, and the foundations of quantum mechanicsРis reviewed. ... In the second part, experiments on the creation and detection of entangled states in atomic systems are discussed along with associated experimental proposals for their refinement. ...
Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...