... Проекта очень хотелось бы, чтобы приоритеты в данном случае . ... Ведь данные конференции - одноразовые мероприятия, . ... образование, и перспективы его развития (а они в данный . ... сообщений о других конференциях и конкурсах, . ... экологического образования я хочу предложить . Вам пользоваться нашим списком рассылки "NATURE". ... Список рассылки NATURE . ... LISt * Список конференций . REView list * Список подписчиков конференции list . ... INDex list * Список файлов конференции list . ...

Еще в разделе: (Показать все результаты (>14) - www.ecocoop.ru/ )

• http://www.ecocoop.ru/eco/archive1/messages/531.html
• http://www.ecocoop.ru/hydro/archive1/messages/61.html
• http://www.ecocoop.ru/monitor/archive1/messages/19.html

... It was necessary to construct quite a different type of parachute to be light, compact, encased in a parapack and reliable. At first most parachute designers considered it to be hardly possible for a canopy to open in the air without the aid of some special devices, such as an umbrella spokes, compressed air or powder explosive charges. ... Later on a great number of different parachute systems were worked out and introduced by Russian parachute designers Nikolai Lobanov, Igor Glushkov and others. ...

Еще в разделе: (Показать все результаты (>4) - margaret.imec.msu.ru/ )

... Malvina Guseva, Vladimir Babaev, and Valery Khvostov, 'Carbyne a linear chainlike carbon allotrope', Chemistry and Physics of Carbon, A series of Advances, edited by Peter A. Thrower, 1997, v.25, p.1-69 . V.G.Babaev, M.B.Guseva, 'Ion-assisted condensation of carbon', in: Carbyne and Carbynoid Structures, ed. by R.B.Heimann, S.E.Evsyukov, L.Kavan, Kluwer Academic Publishers, Dordrecht/Boston/London, 1999, pp. ... Copernicus I . ...

Еще в разделе: (Показать все результаты (>8) - physelec.phys.msu.ru/ )

• д.ф.-м.н., в.н.с. Гусева Мальвина Борисовна

... In vitro, the protein S7 of Thermus thermophilus is able to form complexes with both the minimal 16S rRNA fragment and the intercistronic region of the str operon mRNA from E.coli (Kd = 1.4x10-7 M and 1.1x10-7 M respectively). ... The filter binding assay. ... The most striking result of our study is that thermophilic protein S7 binds strongly to the E.coli S12-S7 intercistronic region of str mRNA in vitro, inspite of the lack of the functionally analogous thermophilic extended region. ...

Еще в разделе: (Показать все результаты (>6) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2002_1.pdf
• http://rnp-group.genebee.msu.su/pdfs/MolRus4_01RassokhinLO.pdf
• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2003.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• ConClus

... РЕШЕНИЕ ЗАДАЧ СФЕРИЧЕСКОЙ АСТРОНОМИИ . ... Вычисление точных топоцентрических эфемерид планет . ... В качестве примера в нем приведены исходные данные сервера для расчета эфемерид Марса. Ниже списка располагаются четыре кнопки для модификации исходных данных. ... Через некоторое время, которое в основном определяется скоростью передачи данных по сети, на экране появиться большая таблица рассчитанных значений параметров, снабженных многочисленными комментариями. ...

Еще в разделе: (Показать все результаты (>15) - heritage.sai.msu.ru/ )

... The Mechanism was extensively studied and heroically publicized by the late Derek de Solla Price in a book, Gears from the Greeks (de Solla Price 1975), and a Scientific American article "An Ancient Greek Computer" (de Solla Price 1959). ... De Solla Price speculates that the mechanism is "cranked" by a now lost handle that turned a contrate (as yet unidentified) gear that in turn rotated a Sun position dial and the main drive wheel. ... Roumeliotis M at www.noc.uom.gr/mr/Antikythera/index.html 2000...

Еще в разделе: (Показать все результаты (>73) - hbar.phys.msu.ru/ )

• newtrev1.htm
• Critical remarks
• DIONYSIUS EXIGUUS. LIBER DE PASCHATE SIVE CYCLUS PASCHALIS

... CELL BIOPHYSICS Application of a Photosystem II Model for Analysis of Fluorescence Induction Curves in the 100 ns to 10 s Time Domain after Excitation with a Saturating Light Pulse N. E. Belyaevaa, V. Z. Pashchenkoa, G. Rengerb, G. Yu. ... In the case of weak measuring light, the steady-state level of fluorescence induction curve (Fig. ... The model of PSII predicted that, upon long (10 s) exposure to weak measuring light, the states with open RCs are being populated (Fig. 4, curves 3, 5 QA). ......

Еще в разделе: (Показать все результаты (>32) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/PDF/3345.pdf

... Unit I. Geologic Hazards and Man Unit II. ... Amazing Earth. ... Трансформируйте словосочетания в предложения. 1. geologic processes going on for millions of years 2. any geologic process can become a geologic hazard 3. some geologic hazards having resulted in disaster 4. many geologic hazards have affected the activity of man 5. a lot of earthquakes resulting in landslides 6. some naturally occurring hazards 7. many disasters are caused by geologic hazards 8. some ...

Еще в разделе: (Показать все результаты (>3) - geol.msu.ru/ )

... MSU Web Sites . ... General Information . ... The MSU School of Television Board of Regents consists of Oleg Dobrodeev, head of the VGTRK; Anatoly Iksanov, Director General of the Bolshoi Theatre; Anatoly Lysenko, president of the Russian Academy of Television and Radio Broadcasting; Vladimir Mamontov, Editor-in-Chief of the Izvestiya newspaper; Alexander Ponomaryov, Director General of the television channel TV-Centre; Viktor Fyodorov, Director General of the Russian State ...

Еще в разделе: (Показать все результаты (>34) - www.msu.ru/ )

• Victor T. Trofimov. Vice-Rector

Moscow State University Belozersky Institute of Physico-Chemical Biology . Department of Electron Microscopy is a sub-division of A.N. Belozersky Institute of Physico-Chemical Biology . ... We are interested of how eukaryotic cell is organized, formed and functioned. Since A.N. Belozersky Institute of Physico-Chemical Biology is one of the scientific departments of Moscow State University ? ... Understanding the metaphase chromosome architecture remains a basic challenge in cell biology. ...

214. UFFO | Университетский спутник "Ломоносов"

215. http://dis.bio.msu.ru/States/Milko_Kreier_2007_en.pdf

216. FPGA Design

217. http://www.spa.msu.ru/kafedra_21.html

218. Кафедра математики Физического Факультета МГУ им. М.В. Ломоносова | Наши

219. http://xray.sai.msu.ru/~polar/sci_rev/1308.html

220. Phenolic Resins: Chemistry, Applications, Standardization, Safety, and Ecology.