A.Nekipelov Modernization of Basic Research in Russia: Russian Academy of Sciences ( RAS ) Vision Joint Session of Russian Academy of Sciences, Institute of France Academy of Sciences and Academy of Technology of France Paris, 2010, September 28 1 RAS in Russian Basic Science Potential (per cent, 2008) Russian Federation Research Organizations 100,0 RAS 12,7 Overall Personnel ... Who is the main actor in research: an institute or a laboratory? ...

Еще в разделе: (Показать все результаты (>18) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/Bassanini_Mosca_rev4.pdf

RAPID COMMUNICATIONS PHYSICAL REVIEW A, VOLUME 62, 011802 R High-intensity pulsed source of space-time and polarization double-entangled photon pairs Yoon-Ho Kim,* Sergei P. Kulik, and Yanhua Shih Department of Physics, University of Maryland, Baltimore County, Baltimore, Maryland 21250 Received 4 April 2000; published 13 June 2000 Two spatially separated type-I nonlinear ... Two orthogonally oriented type-I BBO crystals are placed collinearly and pumped by 45° polarized femtosecond pulses. ...

Еще в разделе: (Показать все результаты (>80) - qi.phys.msu.ru/ )

• http://qi.phys.msu.ru/papers/2011-jetpl(e)-94-262.pdf
• http://qi.phys.msu.su/papers/2006-jetp(e)-102-712.pdf
• http://qi.phys.msu.ru/kulik/Papers/p1_1.pdf

www.elsevier.nl/locate/ica Inorganica Chimica Acta 305 (2000) 1 ­ 6 Increased catalytic activity of primary amine palladacycles in biomimetic hydrolysis of N -t-BOC -S -methionine p -nitrophenyl ester Sergey A. Kurzeev a, Gregory M. Kazankov a, Alexander D. Ryabov a a,b, * Department of Chemistry, M.V. Lomonoso6 Moscow State Uni6ersity, 119899 Moscow, Russia b G.V. Plekhano6 Russian Economic Academy, Stremyanny per. ... Keywords: Kinetics; Hydrolysis; Palladium complexes; Cyclometalated complexes 1. ...

Еще в разделе: (Показать все результаты (>98) - www.enzyme.chem.msu.ru/ )

• http://www.enzyme.chem.msu.ru/ryabov/pdf/CEJ_99.pdf
• proj_past
• PubMed medline query

... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...

Еще в разделе: (Показать все результаты (>2) - www.ccl.msu.su/ )

... Seminars . ... Group 417 [ PDF ] Students are expected to attend lectures and seminars which is the standard forum for class communication. ... Some of the homework problems might appear on the tests and the exam. ... Your class grade total percentage is given by 40% seminar and homework, 25% first test and 35% second test. ... Students with the class grade 5 and 4 may get a final course grade without a final exam, but only upon the recommendation of seminar assistants. ... Test 1 [ PDF ] . ...

Еще в разделе: (Показать все результаты (>31) - nanofluidics.phys.msu.ru/ )

• Laboratory of Micro- and Nanofluidics

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• ConClus

... Carbamide . ... Moscowљ? ... URALCHEM and Stamicarbon will develop a new technology for urea production . URALCHEM, a leading Russian producer of nitrogen fertilizers, signed a joint technology development agreement for the synthesis of urea with Stamicarbon, the world's top developer and licensor of urea processes. ... Laboratory of Chemical Thermodynamics љwasљestablished by Prof. Adam V. Rakovsky (corresponding member of USSR Academy of Sciences) first as a "halurgy laboratory" in 1930. ...

Еще в разделе: (Показать все результаты (>4) - td.chem.msu.ru/ )

MSU Scientific Library Physics Faculty Library . UDK: universal decimal classification . ... Bible at Gateway.com (available different languages) Bible Bible-center . The list of literature links . ... William Burroughs see also William Burroughs . Library Network . Kharuki Murakami Kharuki Murakami. ... Different funny stories . Perseus Project (Perseus is an evolving digital library, engineering interactions through time, space, and language.) ... The Public's Library . ...

Еще в разделе: (Показать все результаты (>15) - astrometric.sai.msu.ru/ )

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... When detection of the change-points in alpha band power was performed as in the previous subsection, more than one change-point per second was obtained in average. ... The hypothesis of the hierarchy of EEG segmental descriptions (Kaplan 1998) (see subsection 7.3.2) is a theoretical reason for introducing the adjustment of the change-point detection probability. ...

Еще в разделе: (Показать все результаты (>50) - brain.bio.msu.ru/ )

• Laboratory for Neurophysiology and Neuro-Computer Interfaces (NNCI) (former
• Change-points in EEG components with different pattern

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>4) - npidb.belozersky.msu.ru/ )

... Настоящим выпуском антропологи МГУ объявляют о появлении нового издания 'Вестник Московского университета. Серия ХХIII. Антропология'. ... В продолжение традиций мы надеемся, что 2009 год станет годом обновления Музея антропологии Московского университета, который откроется в Старом здании на Моховой после ремонта и реконструкции. ... Балахонова Е.И. Африканские коллекции из Московского Публичного и Румянцевского музея в Музее антропологии МГУ. ... А.Л. Пурунджан (1947-2009) Открыть . ...

Еще в разделе: (Показать все результаты (>23) - www.anthropos.msu.ru/ )

Synthesis and Use of Humic Derivatives Covalently Bound to Silica Gel for Np(V) Sequestration I.V. Perminova , L.A. Karpiouk, N.S. Shcherbina*, S.A. Ponomarenko§, St.N. Kalmykov, and K. Hatfield Department of Chemistry, Lomonosov Moscow State University, Moscow 119992, Russia Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow 119991, Russia § Institute of Synthetic Polymer ... I.V. Perminova, et al. ...

Еще в разделе: (Показать все результаты (>139) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2008/2008-kholodov-retention.pdf
• http://www.mgumus.chem.msu.ru/ihss/pdf/slovakia-2005.doc
• http://www.mgumus.chem.msu.ru/publication/2012/2012-karpiouk-self.pdf

The Nine Planets is best viewed on-line via a graphical WWW browser which displays the pictures in color and supports hypertext link traversal. ... To view the movies and hear the sounds, you'll need additional helper programs. ... I recommend that you use Netscape as your browser. Netscape can display gif and jpeg images directly without need of any additional helper apps. You do need additional helper apps for movies and sounds, however. ... Yahoo's Helper Applications .. ... Tech Help .. ...

Еще в разделе: (Показать все результаты (>2) - www.iki.rssi.ru/ )

MASS Software Version 2.04 User Guide V.Kornilov, N.Shatsky, O. Voziakova Decemb er 30, 2003 Contents 1 MASS software op eration overview 1.1 Main features of measurement pro cess with MASS instrument . ... 2 Installation, tuning and startup 2.1 Installation of the MASS software Turbina 2.2 Editing the configuration file . ... 4.2 Output data in MASS Software . ... 4.2 Output data in MASS Software The output of Turbina program op erating the MASS device is directed to an ASCI I file called mass-file. ...

Еще в разделе: (Показать все результаты (>22) - curl.sai.msu.ru/ )

• http://curl.sai.msu.ru/mass/download/doc/massug_eso.pdf
• http://curl.sai.msu.ru/mass/download/doc/sv_ug.pdf
• http://curl.sai.msu.ru/mass/download/doc/dimm_soft_description.pdf

... Dear creators of the Bensons courses! First of all I would like to thank you for such a magnificent English course! ... Look, it's really much more interesting - to listen to a virtual book, to look through the pictures, let alone role-play! ... However, I'm very glad that I took up "Bensons" - the course has given me wonderful possibilities to learn more about English culture, to fill some gaps in my knowledge of English grammar and just to spend my time with great pleasure and benefit! ...

Еще в разделе: (Показать все результаты (>7) - anazarenko.ffl.msu.ru/ )

• Факультет иностранных языков МГУ. Центр Дистанционного обучения.
• Бродецкая Александра

... Scaliger sometimes forgot as anyone will when doing chronological computations whether he sought a current or a completed year, and therefore gave Julian dates that did not actually match the cyclical dates his computations had determined (e.g. eras 37,42, and 49). ... This table lists all the eras explicitly given as such by Scaliger, with their positions in the Julian Period and their dates in years BC or AD. ... To find a year in this era, subtract 296 from the date in the era of the Hegira. ...

Еще в разделе: (Показать все результаты (>75) - hbar.phys.msu.ru/ )

• The Theft of the Millenium. Review on a Review.

Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...

Еще в разделе: (Показать все результаты (>7) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~sveta/lecture1_formal_methods.pdf
• http://lvk.cs.msu.su/~sveta/SDN_OpenFlow_controllers_lecture2.pdf

... Annex (e.g. 3.1) (3) Paragraph/ Figure/Table/ Note (e.g. Table 1) 4 Type of comment2 5 Comment (justification for change) by the MB Date: (6) Document: (7) Secretariat observations on each comment submitted Proposed change by the MB RU RU RU RU 2 2 2 2 Row 2 Row 4 Row 4 Row 5 ed ed ed te SEPs are not fluxes , but particles It is desirable to add that Wolf number is also known as the sunspot number. ... CLOSED: Accepted and implemented in modified form CLOSED: Accepted and RU 2 Row 16 . ...

Еще в разделе: (Показать все результаты (>8) - srd.sinp.msu.ru/ )

• Rikho Nymmik

VARIABLE STARS, THE GALACTIC HALO AND GALAXY FORMATION C. Sterken, N. Samus and L. Szabados (Eds.) 2010 Formation Mechanisms for Spheroidal Stellar Systems O. K. Sil'chenko 1 Sternberg Astronomical Institute of the Moscow State University, Moscow, Russia Abstract. Spheroidal stellar systems on various scales include elliptical galaxies, dwarf spheroidal galaxies, and globular stellar clusters. ... The formation mechanisms of the oldest globular clusters represent a puzzle yet. ... 2009). ...

Еще в разделе: (Показать все результаты (>46) - sn.sai.msu.ru/ )

• MPFS reduction routines HELP

Заведующий кафедрой Head of the Chair . ... История кафедры . ... В 1966 г. для расширения ведущихся на кафедре научных работ в НИИ Ядерной физики МГУ был создан отдел физики плазмы (ОФП), в 1989 году переименованный в отдел микроэлектроники (ОМЭ). ... Сегодня по различным научным направлениям, ведущимся по специальностям, преподаваемым на кафедре атомной физики, физики плазмы и микроэлектроники, работает около 100 научных сотрудников, среди которых 12 докторов наук и около 50 кандидатов наук. ...