... Правила проведения зимней экзаменационной сессии на геологическом факультете МГУ . ... Курс ориентирован на освоение студентами основных методов работы на компьютере и различных периферийных устройствах (принтеры, плоттеры, сканеры, дигитайзеры и т.д.), знакомство с существующими ... так и общего назначения) для решения конкретных геологических задач (построение различной геологической графики, работа с базами данных , моделирование геологических процессов, оформление отчетов, статей и т.п.) ...
звоните, мы в Москве(926)6667253 art-sale@mail.ru . Начало www.99ru.ru Виниловые пластинки ссср 5468 . ... Искусство . История.Философия . ... Художественные . ... История Всемирная . ... Искусство и культура . ... Другие виды искусства . ... Теория искусств.Эстетика . ... Этнография Фольклор . ... Военное дело Военная история . ... Наследие Востока . Наследие Европы, Руны . ... Германское наследие . ... Фольклор . ... Введите код товара из каталога. автор Валерия . ... Валерия . ...
... Otherwise we will never recognize you and your homeworks. ... Afterwards you can go ahead and upload your homework to the system. You can also find your rating. ... To upload Homework - choose the corresponding task and press "Submit". labadmin's blog . ...
Координатор семинара : академик РАН и Academia Europaea Алексей Ремович Хохлов . ... Заседания семинара проводятся в Конференц-зале Института элементоорганических соединений им. А.Н. Несмеянова РАН ( ИНЭОС РАН , г. Москва, ул. Вавилова, 28). ... Скачать объявление о семинаре . ... Б.М. Графов (Интститут физической химии и электрохимии имени А.Н. Фрумкина РАН, Москва) . ... После доклада предполагается обсуждение целесообразности организации Общемосковского семинара по электрохимии. ...
... Porokhov, N., Levin, E., Chukharkin, M., Rakov, D., Vorob'eva, A., Varlashkin, A., and Snigirev, O. High-temperature superconducting films on flexible substrates for flux transformers.љ Journal of Communications Technology and Electronics 57 , 10 (2012), 1130?1137. DOI љ] . ... Радиотехника и электроника 57 , 7 (2012), 1128?1138. ... Home . Research groups . Devices based on LTS and HTS . ... Superconducting electronics . ... Molecular single-electronics . ...
... Departments . ... Geophysical methods of the earth crust exploration . ... Geology of Russia . ... The Head of the Geophysical Department, Professor V.K. Khmelevskoy The Chair trains students in the following areas of specialization: General Geophysics (with getting the Bachelor s degree, 4-year study); Gravity and Magnetic Prospecting , Electrical Prospecting , Hydrogeological and Engineering Geological Geophysics (with getting the diploma of Specialist, 5-year study) as well as...
... Publications . ... Borisov A. V. , Kilin A. A. , Mamaev I. S. , Tenenev V. A. The dynamics of vortex rings: leapfrogging in an ideal and viscous fluid . ... Vetchanin E. V. , Mamaev I. S. , Tenenev V. A. The Self-propulsion of a Body with Moving Internal Masses in a Viscous Fluid . ... Vetchanin E. V., Tenenev V. A., Shaura A. S., Motion control of a rigid body in viscous fluid, Computer Research and Modeling, 2013, vol. 5, no. 4, pp. ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...
... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...
... Individual SELEX products, aptamers, are small molecules (40100 nt) that have a unique three-dimensional structure, which provides for their specific and high-affinity binding to targets varying from low-molecular-weight ligands to proteins. ... Selection of aptamers binding with a target is the key step in SELEX, as aptamers account for only a small fraction of the initial library (one aptamer per 109 to 1013 molecules) [6]. ... Fourth, modification can increase the aptamer affinity for a target. ...
[
Текст
]
Ссылки http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf -- 375.6 Кб -- 21.10.2002
[
Текст
]
Ссылки http://rnp-group.genebee.msu.ru/pages/pdf/molbio2000.pdf -- 375.6 Кб -- 18.02.2008 Похожие документы
... Лаборатория компьютерной безопасности создана совместным решением руководства Московского государственного университета и Федерального агентства правительственной связи и информатики (ныне ФСБ РФ) в 1999 году. ... Задачи лаборатории - разработка специализированного программного обеспечения для защиты информационных ресурсов органов государственной власти и стратегических объектов Российской Федерации. ... Комплекс ТЕСТ, который предназначен для исследования и сертификации программного обеспечения. ...
... XI--XVII . ... Ac A d e m I c r e A d I N g S Conference «Old Russian literature and television» M.V. Ivanova. old russian literature and contemporary russian television . ... e-mail: lanskoy@mail.ru. ... online. 28 2007, 13:00. http://www. expert.ru/interview/2007/03/28/pavlovsky/ 21 , , , . ... 2006, 39. http://www.expert. ru/printissues/expert/2006/39/prodazha_livejournal/print 22 , . ... 2007, 31. . ... 1917--1918 . ... Key words: Old Russian literature, plot, demonology, old printing Prologue. ...
[
Текст
]
Ссылки http://www.ftv.msu.ru/hst-notes/notes_2.pdf -- 1574.8 Кб -- 06.12.2010
[
Текст
]
Ссылки http://ftv.msu.ru/hst-notes/notes_2.pdf -- 1574.8 Кб -- 06.12.2010 Похожие документы
Исправлена функция сворачивания/разворачивания разделов структурного указателя. ... Исправлено выделение ключевых слов поиска при показе содержания статей. ... Исправления в графе: добавлена обработка ошибки, возникающей, когда на одном уровне слишком много вершин. ... Исправления в графе: исправлена ошибка инициализации, изменена задержка в режиме двигания вершин. ... В графе исправлена ошибка в работе функции "shake": теперь ее применение не перемещает вершины за пределы видимой области. ...
... Nonlinear optics of ionized mediums . Fiber lasers . ... Emergence of powerful laser systems, being able to deliver powerful ultrashort light pulses, allows one to investigate and exploit new class of nonlinear-optical phenomena, based on the media ionization, when the electrons are released by strong electromagnetic field directly or by collision of an atom with another electron accelerated in the field. ... Ultrafast optical switching of an ionized medium by interfering ultrashort laser pulses. ...
... Семинары . ... UNИX . ... Immutable Page . Comments . ... Attachments . More Actions: Raw Text Print View Render as Docbook Delete Cache ------------------------ Check Spelling Like Pages Local Site Map ------------------------ Rename Page Copy Page Delete Page ------------------------ My Pages Subscribe User ------------------------ Remove Spam Revert to this revision Package Pages Sync Pages ------------------------ Load Save SlideShow . ... Участие в семинаре. ...
... Научно-методический совет по иностранным языкам . ... Факультет иностранных языков и регионоведения . МГУ им. М.В. Ломоносова . Центр Дистанционного Образования Кафедра лингвистики и ИТ . ... которая состоится 10-11 июня 2010 г. на . факультете иностранных языков и регионоведения . ... Педагогические технологии обучения иностранным языкам с применением ИКТ: компьютерно-опосредованное обучение; . ... Дидактические аспекты дистанционного обучения иностранным языкам; . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
This domain may be for sale - этот домен возможно продается . ... The gathered information about your visits to this and other websites are used by these third party companies in order to provide advertisements about goods and services of interest to you. ... If you would like more information about this practice and to know your choices about not having this information used by these companies, click here . ...
Radiochemical Approach for Studying Properties of Humic Substances Maria G. Chernysheva1, Gennady A. Badun1, Irina V. Perminova1, Viktor I. Korobkov1, Zinaida A. Tyasto1, Elena Yu. ... To prove the developed technique of HS labeling with tritium, parent HS and obtained samples of 3H-HS was analyzed by SEC with radioactivity and UV detection. ... To characterized hydrophobic and surface activity properties of HS under study, the obtained 3H-HS samples of corresponding initial humic materials were used. ...
[
Текст
]
Ссылки http://www.mgumus.chem.msu.ru/publication/2008/2008-chernysheva-radiochemical.pdf -- 322.6 Кб -- 23.12.2008
[
Текст
]
Ссылки http://mgumus.chem.msu.ru/publication/2008/2008-chernysheva-radiochemical.pdf -- 322.6 Кб -- 23.12.2008 Похожие документы
... The nonlinearity has the form of a sigmoid function of two parameters a and b. The zoning of the plane (b; a) with respect to the number and type of stationary states (critical points) for the model under consideration is performed. ... The function g(u) (called a shot function) is expressed by g(u; a; b) = 1 1 + a exp(\Gammabu) (2) where the parameters a and b are positive. ... Analysis of critical points. ... The centertype stable critical points correspond to a minimum of the function U (u) [3]....
[
Текст
]
Ссылки http://num-anal.srcc.msu.su/list_wrk/ps1/ch4st3.ps -- 76.5 Кб -- 17.12.2002
[
Текст
]
Ссылки http://num-anal.srcc.msu.ru/list_wrk/ps1/ch4st3.ps -- 76.5 Кб -- 17.12.2002 Похожие документы
... О проекте . ... A prototype of laser unit for Laser Electron X-Ray Generator is constructed on the basis of the optoelectronic control. The laser system in which an optoelectronic negative feedback is realized by means of a signal reflected from an intracavity Pockels cell polarizer is proposed and tested. The design provides flexible control over pulse train time structure. ... Berlin06_Laser.pdf . ...