Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Magnetospheric particles and radiation conditions . ... Scientific equipment . ... Scientific payload of the ?Lomonosov? satellite will include a complex of the devices ELFIN-L and DEPRON for the studies of the processes of the charged particles penetration into the upper atmosphere of the Earth and for the analysis of the radiaiton conditions at low altitudes. ...
... Journals . Memoirs of the Faculty of Physics . Moscow University Physics Bulletin . ... The conference papers from the School-Seminar ?Waves-2014? will be submitted for publishing in the Memoirs of the Faculty of Physics journal. ... Moscow University Physics Bulletin was founded in 1946 by Lomonosov Moscow State University and the Faculty of Physics. ... World-known physicists working at the Faculty of Physics (including 8 Nobel laureates) used to be and are the authors of the journal. ...
... About CIE MSU . Academic Programmes . Admissions . ... Vestnik CIE (in Russian) . ... Homepage > Admissions > . Study Periods . 2014-2015 academic year . ... One academic year programme: . September 2014 - June 2015 . Arrival Dates . ... August 28 October 31 . June 2015 . One and a half academic year programme: . ... STUDY PROGRAMMES AND COURSE DATES . ... September 20 15 - June 20 16 . ... Study Period . ... Recommended Arrival Dates . ... June 2 6 June 29 . ...
... You must have cookies enabled to log in to MediaWiki. ... Retrieved from " http://algcourse.cs.msu.su/teachwiki/index.php/Special:UserLogin " . Special page . 93.180.27.85 . Talk for this IP address . Log in . ... 1-й семестр 2015 г. Материалы по системе ejudge . ... Special pages . ... About MediaWiki . ...
HOW DOES CRYSTAL CHEMISTRY PREDICT STRUCTURE AND PROPERTIES OF CRYSTALS V. S. URUSOV Crystal chemistry has created a set of methods and procedures to predict structure and properties of crystals. ... З. л. мкмлйЗ еУТНУ,ТНЛИ ,,УТЫ ТЪ,ВММњИ ЫМЛ,В ТЛЪВЪ ЛП. е.З. гУПУМУТУ, ї м ЫТУ, З.л., 1997 . ... мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм.. ... 1 мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм а лЗйвлнЗД дкалнДггйЗ 43 . ... Ti4+ 2 -, 1 : 2 , . 2 --2 - Ti4+-Ti4+) , (2 --Ti4+). ...
Семинар по социофизике . ... 22 сентября 2015 (вторник) . химический факультет МГУ, ауд. 337, Начало в 17.30 . ... Аннотация доклада . Презентация доклада - 1 . ... Информация о конференции "Социофизика и социоинженерия", . прошедшей в МГУ 6-11 июня 2015 г. 3. ... Вебдизайн: Copyright (C) И. Миняйлова и В. Миняйлов . Copyright (C) Химический факультет МГУ . ...
Самсонов В.А., Шамолин М.В. К задаче о движении тела в сопротивляющейся среде // Вестн. ... Шамолин М.В. Определение относительной грубости и двупараметрическое семейство фазовых портретов в динамике твердого тела // Успехи матем. наук. ... Шамолин М.В. Случаи интегрируемости уравнений движения четырехмерного твердого тела в неконсервативном поле сил // 'Современные проблемы математики, механики и их приложений'. ... Шамолин М.В. Движение твердого тела в сопротивляющейся среде // Матем. моделирование. ...
... О кафедре . ... Научная работа . ... Главная Научная работа Математические модели взаимодействия элементарных и структурированных объектов . ... Ведущий научный сотрудник Эльтеков В.А. В разное время в состав группы входили: Н.Н.Шапошников, А.В.Овсянкин, В.Б.Шикалов, Н.Г.Васичкина (кафедра математики), Л.П.Развина, О.В.Попова, Н.Н.Негребецкая (кафедра физической электроники), В.Н.Самойлов, Н.Г.Ананьева (кафедра общей физики). ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова . ...
Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Moscow, 2008 Acknowledgements A.Belinskiy M.Kornilov A.Tokovinin M.Kuznetsov P.Kortunov E.Gorbovskoy SAI administration some SAI students Pulkovo solar station (KHSS) staff RFBR support MAVEG Gmbh Why to study optical turbulence and some other relevant ... Mean seeing by DIMM data for this night is 1''5. ...
... Further tests of the radiocarbon method of age determination (1 3, 6, 8,1 0) for archaeological and geological samples have been completed. All the samples used were wood dated quite accurately by accepted methods. ... TABLE 1 Age Determinations on Samples of Known Age . ... Specific activities for samples of known age. ... The former sample was cypress wood and the latter acacia. ... This committee advised us what samples of known age to use for testing and greatly assisted us in procuring them. ...
... Faculty of Physics . ... Research Centers . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...
RUSSIAN version . ... Sergei V. OGURTSOV . ... In 2002-2009 worked as a research scientist in the Department of Vertebrate Zoology of the Faculty of Biology MSU. Ph.D thesis entitled 'Learning the native pond odour as one of the mechanisms of chemosensory orientation of anuran amphibians' at Faculty of Biology MSU in 2004. ... Ogurtsov S.V., 2004. Olfactory orientation in anuran amphibians // Russian Journal of Herpetology, V. 11, ?1, p. 35-40. [download pdf-file] . Ogurtsov S.V., 2005. ...
... Разработка и внедрение образовательных программ повышения квалификации специалистов в области инновационной деятельности . ... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 06/04/2016 . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... 27 марта 2016 года Московский государственный университет имени М.В.Ломоносова приглашает на весенний ДЕНЬ ОТКРЫТЫХ ДВЕРЕЙ . ... New technologies in gas chemistry . ...
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
Human longevity at the cost of reproductive success: evidence from global data ц б F . ... Abstract A trade-off between reproduction and somatic maintenance and hence survival is fundamental to life-history theory. We investigated the relationship between female fecundity and longevity in Homo sapiens using data from 153 countries located all over the world. The raw correlation between life span and fecundity was highly signi®cant with a negative trend. ... 1998; Polis et al., ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2000_Longev_JEvolBio.pdf -- 97.8 Кб -- 16.03.2009 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Status of mTCA Slow Control development at CMS Petr Volkov Lomonosov Moscow State University Skobeltsyn Institute of Nuclear Physics, Russia 6/27/2015 P. Volkov SINP MSU 1 uTCA: Introduction MicroTCA® - open standard for fabric computer systems. MicroTCA systems are both physically small and non-expensive. ... Use PVSSII and the JCOP Framework to develop your control applications. These are the official CMS DCS developing tools. ... CMS_MTCA_HCALTR_CRATE1 CRATES.. ...
[
Текст
]
Ссылки http://qfthep.sinp.msu.ru/talks2015/Qfthep_mTCA_PVolkov.pdf -- 2913.0 Кб -- 18.06.2015 Похожие документы
Information Security Meeting Schedule Thursday, March 30 12:00 noon Opening and Catered Lunch 1:00 R. Sekar, Stony Brook University - Ongoing Research at Secure Systems Laboratory at Stony Brook University 1:30 Scott Craver, Binghamton University - Information Hiding and Counterdeception 2:00 Sanjay Goel, University at ...
[
Текст
]
Ссылки http://www.suny.msu.ru/ru/ProgrBufMar2006.doc -- 32.5 Кб -- 24.08.2010
[
Текст
]
Ссылки http://suny.msu.ru/ru/ProgrBufMar2006.doc -- 32.5 Кб -- 24.08.2010 Похожие документы
... Men'shov I.S., Strong blast wave propagation in disperse mixture, Dokl. ... Men'shov I.S., Propagation of shock and detonation waves in dust-laden gases, Izvest. ... Men'shov I.S., Nakamura Y., Numerical Simulation of Nonequilibrium Air Flow over Spheres, in: Proc.27th Fluid Dynamics Conf., ... T. Saito, T. Nakamura, I. Men'shov, Y. Nakamura, Numerical Investigation of Ignition Overpressure Caused by Rocket Plume, Proceedings of the 35th Japan Fluid Dynamics Conference, Kyoto, Sep. 2003, pp. ...
... 9) Oknyanskij V.L. 1994, "Optical-radio time delays in Q0957+561", Odessa Astronomical Publ., ... 11) Oknyanskij V.L. 1994, "Connection between X-ray and optical variability in NGC4151", in Proceedings of Int. Conf. ... 1994. 12) Oknyanskij V.L. 1994, "Connection between X-ray and optical variability in NGC4151", Astrophys. and Space Science, 222, p.157. ... 14) Oknyanskij V.L., van Groningen E., 1997, "Optical spectral variability of NGC4151 in 1990", Astronomical and Astrophys. ...