... Доктор филологических наук профессор Юрий Николаевич МАРЧУК является видным специалистом по прикладной и компьютерной лингвистике , машинному переводу, автоматическому анализу и синтезу текстов, терминологии и терминоведению, лексикологии и лексикографии, общему языкознанию. ... Белов Алексей Михайлович, преподаватель, кандидат филологических наук . ... Качалкин Анатолий Николаевич, профессор, доктор филологических наук . Кочергина Вера Александровна, профессор, доктор филологических наук . ...
A.A. Mailybaev and A.P. Seyranian , . Multiparameter Stability Problems. Theory and Applications in Mechanics , . ... A.P. Seyranian and I. Elishakoff , eds. Modern Problems of Structural Stability , . ... Structural Optimization under Stability and Vibration Constraints , . ... Stability and Catastrophes of Vibrating Systems Depending on Parameters . ... Evan- Ivanowski R.M., eds ), 1993, DE- Vol . ... Optimization. ... System optimization by oscillation and stability criteria . ...
... В данном разделе приводятся и кратко описываются основные источники информации по тематике компьютеров на базе ПЛИС. FPGA-FAQ . ... http://www.fpga4fun.com/ . ... http://en.wikipedia.org/wiki/FPGA . http://ru.wikipedia.org/wiki/%D0%9F%D0%9B%D0%98%D0%A1 . ... http://www.tutorial-reports.com/computer-science/fpga?PHPSESSID=b0807160c969a1706c5477d257c18f97 . http://www.gaw.ru/html.cgi/txt/ic/Xilinx/plis/plis_fpga.htm . http://www.fpga.ru/ . ... http://www.osp.ru/cw/1997/36/23812/ . ...
... The latter should be taken into account and carefully modeled as a fluid-structure interaction (FSI) problem. A patient- specific FSI analysis is impossible because it predicts only estimated hemodynamic features which are based on assumptions regarding material properties. The objective of this study is to develop a new methodology that assimilates medical imaging data for quantitative hemodynamic data extraction. ...
[
Текст
]
Ссылки http://hit-conf.imec.msu.ru/2012/lectures/Yakhot-abstract.doc -- 21.5 Кб -- 14.06.2015 Похожие документы
BS - 2D data processing program. BS is a windows version of the 2D X-ray data processing program BSL in use at the Daresbury Synchrotron radiation source, for the treatment of low angle diffraction data. ... It requires less memory, has separate window to see 1D graphics and allows export of the image in two common formats: BMP and TIFF. ... information about the data file .adc . add a constant to selected range in n frames from file .add . weighted addition of two images .arg . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Welcome to ASC14 To whom it may concern With the supports from the High Performance Computing (HPC) experts and organizations, the ASC13 Student Supercomputer Challenge has concluded with great success. ... We are calling for registration and preliminary contest preparation. ... Some of them may finally take HPC as a career option, such as some students from National Defense University team have already contributed to the Tianhe-1A and Tianhe2. ... Award Overall Gold Winner: 100K RMB (~16000 USD) . ...
[
Текст
]
Ссылки http://smu.cs.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cs.msu.su/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cmc.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013 Похожие документы
... БИБЛИОТЕКА НИИЯФ МГУ . ... Полный список журналов ELSEVIER и SpringerLink доступных в 2011 году . ... Электронные ресурсы НИИЯФ МГУ . ... Acta Physica Hungarica, New Series, Heavy Ion Physics . ... Applied Physics Letters . ... аннотации . ... Astrophysical Journal, Astrophysical Journal Letters, Astrophysical Journal Supplement series . ... Journal of Physical Chemistry A . ... The European Physical Journal - Applied Physics . ... The European Physical Journal E: Soft Matter and Biological Physics ...
... About hotel . ... New laundry. In hotel there is a laundry for convenience of guests. 22.08.2013 12:20 . Renewed website. The hotel т??69th Parallelт?? is glad to present its renewed website which now has an option of online booking! ... The system of online booking of our site will help you quickly and with guarantee directly to reserve any room both with an advance payment, and with possibility of payment at arrival. ... Reception: +7(8152) 253-700 . 7 (8152) 253-700 . ...
... Acoustical Society of America (ASA) . Ultrasonics Society of India . ... Acoustics Australia . ... Catgut Acoustical Society Journal . ... International Journal of Acoustics and Vibration . ... Journal of Vibration and Acoustics Transactions of the ASME (American Society of Mechanical Engineers) . ... Ultrasonics, Ferroelectrics, and Frequency Control Society of Institute of Electrical and Electronics Engineers (IEEE-UFFC) . ... International Institute of Acoustics and Vibration (IIAV) . ...
Школа танцев Грация-МГУ . ... Грация-МГУ::Форум Общение Общение . ... Нормы не для нас . ... Jan 16 2010, 04:19 . Сообщение #331 . born to create drama . I'll be the last man standing on the ground . ... Сообщение #332 . ... Сообщение #333 . ... Сообщение #334 . ... Сообщение #335 . ... Feb 2 2010, 13:13 . Сообщение #336 . ... Сообщение #337 . ... Сообщение #338 . ... Сообщение #339 . ... Сообщение #340 . ... Подписка на тему Сообщить другу Версия для печати Подписка на этот форум . ...
... Камерный оркестр МГУ . ... http://blankov.narod.ru - информация о старинной музыке, ее исследователях и интерпретаторах . http://www.dk.msu.ru - . ... http://www.rbsp.org/EMLinks/ - Общество R&B - коллекция сайтов по старинной музыке . ... http://classicalmus.interspeed.net/earlyperf.html - Старинная музыка - солисты и ансамбли . http://classicalmus.interspeed.net/early/index.html - Старинная музыка в Интернете . ... http://www.medieval.org/emfaq/ - Старинная музыка (FAQ) . ...
... Сайт физического факультета . Неофициальный студенческий сайт факультета . ... Сайт библиотеки физического факультета . Список online изданий с доступом через физический факультет (в том числе SCOPUS, elibrary, Springer и др.) ... Lightwave Russian Edition 2003 . Lightwave Russian Edition 2004 . Lightwave Russian Edition 2005 . Lightwave Russian Edition 2006 . Lightwave Russian Edition 2007 . Lightwave Russian Edition 2008 . ...
... CUDA Showcase - список приложений, использующих CUDA (на сайте NVidia). RapidMind Case Studies - примеры использования RapidMind для программирования ГПУ (и не только). AMD Stream Computing Blog - примеры использования вычислительной платформы AMD Stream Computing для программирования ГПУ от AMD. Core Image - компонент интерфейса программирования Mac OS X, использующий вычислительные мощности графического процессора для отрисовки эффектов пользовательского интерфейса. ...
... 000, 112 (2009) Printed 11 February 2010 A (MN L TEX style file v2.2) Analytical approximations of K -corrections in optical and near-infrared bands I1gor V. Chilingarian1 2 ,2,3 , Anne-Laure Melchior 1,4 and Ivan Yu. ... Received 2010 February 01; in original form 2009 August 14 ABSTRACT To compare photometric properties of galaxies at different redshifts, the fluxes need to be corrected for the changes of effective rest-frame wavelengths of filter bandpasses, called K -corrections. ... Table 1. ...
... АНАТОЛИЙ ТИМОФЕЕВИЧ ТЕРЕХИН ANATOLY TEREKHIN (TERIOKHIN) . ... Будилова Е.В., Терехин А.Т. Математическое моделирование эволюции жизненного цикла: краткая история и основные направления// Журнал общей биологии, 2010. ... Ponton F., Duneau D., S?nchez M., Courtiol, A., Terekhin A.T., Budilova E.V., Renaud F., Thomas F. Effect of parasite-induced behavioral alterations on juvenile development. ... Терехин А.Т., Будилова Е.В. , Понтон Ф., Дюно Д., Санчес М., Мур Дж., ... Терехин А.Т., Будилова Е.В . ...
О кафедре . ... Главная -> Учебный процесс -> Лекционные курсы -> Пакеты прикладных программ -> Программа курса . Лекционные курсы . ... Языки программирования и библиотеки подпрограмм для численных расчетов ( библиотека численного анализа НИВЦ МГУ, NAG Library, Netlib ). ... Системы компьютерной алгебры и универсальные системы численных расчетов ( Maple, Mathematica, Matlab, Mathcad ). ... Учебный курс. ... 2002 2016 Кафедра Оптимального управления факультета ВМиК МГУ . ...
New photos are on my new site: photo777.org . ... photo . ... Pentax K20D . smc Pentax DA 18-55mm 3.5-5.6 II . smc PENTAX-FA 50mm F1.4 . Submitted by pyotr777 on Wed, 09/11/2011 - 15:01 . ... Hamburg photo gallery. June 3, 2010. ... Hamburg . ... Submitted by pyotr777 on Sun, 13/06/2010 - 18:06 . ... Submitted by pyotr777 on Sat, 12/06/2010 - 00:29 . ... May 29 - June 2, 2010. ... Submitted by pyotr777 on Tue, 08/06/2010 - 23:32 . ... Submitted by pyotr777 on Fri, 28/05/2010 - 10:40 . ...