... 21-Sep-2009 14:04 . ... 01-Dec-2008 10:52 . ... 19-Jun-2009 12:18 . ... 14-Feb-2006 10:46 . ... 12-Jul-2010 21:55 . ...

Еще в разделе: (Показать все результаты (>114) - asa.guru.ru/ )

• Index of /photos/arhis/panoramas
• Index of /photos/patr
• Index of /photos/C-55/panoramas

... In 1997, the work of Jens Skou devoted to discovery and the study of Na,K-ATPase was culminated in the Nobel Prize. ... Our group works in the collaboration with the University of Montrel, Canada (professor S.N. Orlov), and with the Engelgardt Institute of Molecular Biology, Moscow, Russia (Laboratory of conformational stability of proteins and physical methods of analysis, under the guidance of academician A.A. Makarov). ... S-glutathionylation of the Na,K-ATPase catalytic ? ... Biochemistry (Mosc)...

Еще в разделе: (Показать все результаты (>70) - biochem.bio.msu.ru/ )

• Biochemistry Department of Moscow State University | The physiological role of
• Biochemistry Department of Moscow State University | History
• Biochemistry Department of Moscow State University | About us

... K. Marx, F. Engels, Russia, Marxism, capitalism, Revolution, counterrevolution, feudalism, tsarism, russophobia . The article is devoted to the evolution of the analysis of the attitude of K. Marx and F. Engels to Russia. ... The author shows that their sights at Russia changed in connection with development of a situation in the world both in Russia and in connection with development of the marxist theory. ...

Еще в разделе: (Показать все результаты (>76) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2010/4/08.pdf
• http://www.socio.msu.ru/vestnik/archive/2011/1/10.pdf

News from the UNESCO Chair on Global Problems Journal 1/2016 Moscow Russian Federation Lomonosov Moscow State University Faculty of Global Processes Dear colleagues, UNESCO Chairholders and members, international scientists, friends! ... When inaugurating the Chair, the Rector of the University Acad. ... The visit of the UNESCO Director General to the Moscow University represents an important milestone for the development of the multifaceted cooperation between UNESCO and the Russian Federation. ...

Еще в разделе: (Показать все результаты (>2) - unesco.fgp.msu.ru/ )

... Nonlinear fiber optics . ... member of the Editorial Board for the Laser Physics journal . ... Member of the steering committee of the international conference on Raman spectroscopy (ICORS): Budapest, 2002; Brisbane, 2004; Yokohama, 2006; London, 2008 . Member of the steering committee of the International Laser Physics workshop: Bratislava, 2002; Hamburg, 2003; Trieste, 2004; Kyoto, 2005; Lausanne, 2006; Leon, 2007; Trondheim, 2008; Barcelona, 2009 . ... International conference ?Laser Optics? ...

Еще в разделе: (Показать все результаты (>9) - photonicslab.phys.msu.ru/ )

V.S. Chernysh, A.A. Haidarov, V.S. Kulikauskas. ... V.C. Chernysh, W. Eckstein, A.A. Haidarov, V.S. Kulikauskas, V.A. Kurnaev, E.S. Mashkova, V.A. Molchanov. ... В.С. Куликаускас, Е.С. Машкова, В.А. Молчанов, А.А. Хайдаров, В.С. Черныш, В. Экштайн. ... Поверхность, 1999, ?4. ... V.C. Chernysh, W. Eckstein, A.A. Haidarov, V.S. Kulikauskas, E.S. Mashkova, V.A. Molchanov. ... V.S. Kulikauskas, E.S. Mashkova, V.A. Molchanov, A.A. Haidarov V.S. Chernysh and W. Eckstein. ... Поверхность. ...

Еще в разделе: (Показать все результаты (>4) - physelec.phys.msu.ru/ )

THE JOURNAL OF CHEMICAL PHYSICS 133, 144101 2010 Effective numbers of modes applied to analysis of internal dynamics of weakly bound clusters A. A. Rybakov,a E. D. Belega, and D. N. Trubnikov Department of ... Russia Received 11 June 2009; accepted 14 September 2010; published online 11 October 2010 The dependence of the volume of the chaotic component in the internal dynamics of triatomic van der Waals clusters on the angular ... When such difference is small, the regular motion disappears. ...

Еще в разделе: (Показать все результаты (>19) - beams.chem.msu.ru/ )

• http://beams.chem.msu.ru/doc/JMC168.pdf
• http://beams.chem.msu.ru/doc/Dynamical_systems_Theory_and_applications.pdf

... Женский клуб . ... Издательство МГУ . ... Обсуждение статей и публикаций . ... МГУ им.Ломоносова . ... Выпускники МГУ . ... Дайв-Клуб МГУ . ... Последние два года, параллельно с работой в ATI, я учился в магистратуре университета Johns Hopkins и в аспирантуре МГУ. ... В позапрошлом году мне посчастливилось познакомиться с работами В.А. Твердислова, Л.В. Яковенко и других сотрудников кафедры биофизики физического факультета МГУ. ...

Еще в разделе: (Показать все результаты (>782) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: GlowByte
• Клуб выпускников МГУ: Клетки кожи стали клетками мозга в один ход
• Клуб выпускников МГУ: Ученые: молодая кровь - путь к продлению жизни и

... Preliminary Analysis of the Self Similarity of the Aftershocks of the Japanese Earthquake on March 11, 2011 V. S. Zakharov Faculty of Geology, Moscow State University, Moscow, 119991 Russia e mail: vszakharov@yandex.ru, zakharov@dynamo.geol.msu.ru Received October 11, 2011 Abstract--The quantitative parameters of the self similarity of the aftershocks of the Japanese earthquake on March 11, 2011 were obtained. ... Most aftershock hypocenters were located at a depth of 20­50 km. ...

Еще в разделе: (Показать все результаты (>26) - dynamo.geol.msu.ru/ )

• http://dynamo.geol.msu.ru/personal/vsz/papers/Zakharov_2013_2_eng.pdf
• http://dynamo.geol.msu.ru/personal/vsz/papers/Zakharov_2013_3_eng.pdf
• http://dynamo.geol.msu.ru/personal/vsz/papers/Koronovsky_etal_2015_eng.pdf

Presentation (pdf format) on the non-invariance of QD-NEVPT2 theory (September 29th, 2011). ... Presentation (pdf format) on the XMCQDPT theory and its implementation within the PC GAMESS/Firefly (December 10, 2008). ... Second presentation (pdf format) on the large-scale MCQDPT2 code implementation (using resolvent fitting approach) in the PC GAMESS (November 1, 2006). ... Presentation (pdf format) on the large-scale MCQDPT2 code implementation in the PC GAMESS (September 21, 2005). ...

Еще в разделе: (Показать все результаты (>74) - classic.chem.msu.su/ )

• Firefly News
• Firefly Home Page
• PC GAMESS/Firefly DOCUMENTATION - 64-bit processing support

... Полная версия этой страницы: Выставка Extreme photo . Студенческий форум Физфака МГУ > Общий > Общественная жизнь . ... Был сегодня на 4-ой международной выставке экстремальной фотографии, которая в Новом Манеже проходит ) . ... Красивые фотки, клипы и прочее (мазда ))), борды, лыжи, велы - ну они скорее для антуражу))) . Фотки на тему: Горные лыжи, парапланы, парашюты, борд, велы, альпинизм и пр... ... Завтра (4.12) крайний день выставки.. ...

Еще в разделе: (Показать все результаты (>724) - wasp.phys.msu.ru/ )

• Выставка Extreme photo - Студенческий форум Физфака МГУ
• Студенческий форум Физфака МГУ > Прием в аспирантуру Принстонского Университета
• Студенческий форум Физфака МГУ > PhD in Astrophysical Sciences, Princeton, USA

... He distributes these gifts in sacks (each sack can contain from 1 to n items) and puts the sacks with gifts around the Christmas tree (only the content of the sacks and their ordering on the circle around the tree are important). ... A river falling into a sea forms a delta which is a system of branches consisting of channels without inner intersections. (a) Suppose that in a given delta there are exactly n different (i.e. differing by at least one channel) routes down the stream. ...

Еще в разделе: (Показать все результаты (>2) - www.universe.msu.ru/ )

... 6:30 - 7:00pm |Transit to Executive Learning | ... 8:00 - 10:00pm |Dinner |Executive Dining Room | ... 10:30 - 10:45am |Funds |Executive Dining Room | Claude Legrand |10:45am - 12:30pm|Refreshment Break |ELC x.206 | ... 10:30 - 10:45am |Refreshment Break |Executive Dining Room | ... Lunch |Executive Dining Room | ... 2:30 - 2:45pm |Refreshment Break |Executive Dining Room | ... 4:00 - 4:15pm |Refreshment Break |Executive Dining Room | ... 5:15 - 5:30pm |Refreshment Break |Executive Dining Room | ...

Еще в разделе: (Показать все результаты (>2) - www.innovation.msu.ru/ )

Lomonosov Moscow State University, Faculty of Mechanics and Mathematics, Department of the English Language Abstract Categorical Models of Quantum Mechanics By Alexander Zapryagaev, group 304 21 October 2014 The report deals with the axiomatic approach to the phenomena of quantum computation and algorithms. ... Finally, the logic behind quantum operations is discussed: it is revealed that the ideas of quantum algorithms have a strong connection to Jean-Yves Girard's linear logic. ...

Еще в разделе: (Показать все результаты (>23) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/The_Day_The_World_Changed_article_and_vocabulary.pdf

Search Pattern Cookbook The Search function is very powerful. ... Type* | ... Enable the user to filter this list based on the values of !TopicStatus ---+++ Solution verbatim class= tml % SEARCH { TopicClassification='%URLPARAM{ type }%' type = query nonoise= on sort= topic format= * $ topic - font face='arial,helvetica' size='1' _last modified by_ $wikiusername _on_ $date /font %BR% nbsp; nbsp ... This topic: System > WebHome > Macros > FormattedSearch > SearchPatternCookbook . ...

Еще в разделе: (Показать все результаты (>5652) - wiki.cmc.msu.ru/ )

• RegularExpression < System < Foswiki

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

• StructAlign feedback

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>3) - sinp.msu.ru/ )

... High Power Linear Accelerators . Fig 3a: One-section schematic . ... Our CW LINAC family consists of ten accelerators each with beam currents of 50 mA and energies ranging from 0.6 to 6 MeV in increments of 600 keV with corresponding beam power of 30 to 300 kW. ... Fig 4a: Two-section schematic . ... Our two-section CW LINAC seen in Fig. 4 consists of one-section CW LINAC, beam line between first and second AS, and second AS which accelerates the 50 mA beam up to the energy 1.2 MeV. ... 0.6 MeV . ...

Еще в разделе: (Показать все результаты (>5) - vserv.sinp.msu.ru/ )

First Russian Conference "OZONE AND OTHER ENVIRONMENT FRIENDLY OXIDANTS. ... 7-9 June 2005, Moscow . ... State of Art and Perspectives of Ozone Application for Water Treatment in Russian Federation . ... The foreign as well as the native ozonizers are used at these stations. ... State Univ. ... The report on the impulse corona ozonizer (Russian Scientific Centre 'Kurchatov Institute', 'NTC ECOS', Moscow) with ozone synthesized from the undrained air was presented to the participants of the Workshop. ...

Еще в разделе: (Показать все результаты (>19) - www.kge.msu.ru/ )

• Публикации
• Chemistry Journals

... Использование which и that в относительных придаточных предложениях . Придаточное предложение, начинающееся со слова that , всегда является ограничивающим, т.е. такое придаточное предложение запятыми не выделяется. ... Здесь неограничивающий случай: придаточное предложение фиксирует дополнительную, уточняющую информацию о decimal fractions . ... придаточное предложение является ограничивающим, поскольку оно указывает, какие именно decimal fractions correspond to rational numbers . ...

Еще в разделе: (Показать все результаты (>95) - num-anal.srcc.msu.ru/ )

• БЧА НИВЦ МГУ. SF62R. Интегральные и связанные с ними функции
• БЧА НИВЦ МГУ. SF62R_P. Интегральные и связанные с ними функции