... For the case of the circular trajectory, two families of exact solutions are obtained. ... These exact solutions allow us to obtain approximate solutions for the case of an elliptic trajectory of the waist. ... We also check the condition of keeping contact with the waist during twirling. ... Main relations We assume that the center O of a gymnast's waist moves in time according to the elliptic law x = a sin t, y = b cos t with the amplitudes a, b and the excitation frequency > 0, Fig. ...
[
Текст
]
Ссылки http://belyakov.imec.msu.ru/papers/Belyakov_Seyranian_6pages2011.pdf -- 2709.9 Кб -- 30.07.2011 Похожие документы
ДД PROCEEDINGS OF THE 31st ICRC, LODZ 2009 1 Preliminary Proton and Helium Spectra from the CREAM-III Flight Y. S. Yoon , H. S. Ahn , T. Anderson, L. Barbier?, ... Keywords: CREAM; energy spectra; protons and helium nuclei I . ... CREAM-III I N S T RU M E N T A N D F LIGHT The CREAM-III instrument consisted of a tungsten/scintillating fiber calorimeter, a dual layer Silicon Charge Detector (SCD), a Cherenkov Camera (CherCam), a Cherenkov Detector, and a Timing Charge Detector (TCD). ...
International Maize and Wheat Improvement Center No. ... AFRICA "Maize production is likely to suffer the most due to climate change compared to other crops in Southern Africa," said CIMMYT physiologist Jill Cairns, who presented on CIMMYT work under the CGIAR Research Program on Climate Change, Agriculture and Food Security (CCAFS) at the FAO Agriculture Coordination & Information Forum in Harare, Zimbabwe, on 25 July 2013. ... Policy makers in the seed value chain must be engaged as well. ... 2013. ...
[
Текст
]
Ссылки http://ecfs.msu.ru/sites/default/files/node/publication/15/10/e-informa1855.pdf -- 1250.9 Кб -- 06.10.2015 Похожие документы
... 000, 112 (2009) Printed 11 February 2010 A (MN L TEX style file v2.2) Analytical approximations of K -corrections in optical and near-infrared bands I1gor V. Chilingarian1 2 ,2,3 , Anne-Laure Melchior 1,4 and Ivan Yu. ... Received 2010 February 01; in original form 2009 August 14 ABSTRACT To compare photometric properties of galaxies at different redshifts, the fluxes need to be corrected for the changes of effective rest-frame wavelengths of filter bandpasses, called K -corrections. ... Table 1. ...
... The delayed fluorescence of chlorophyll (DF) is an informative characteristic of the backward electron transfer in the reaction centers (RC) as well as of the functional activity of the photosynthetic apparatus (PSA) in vivo and in vitro under various physical and chemical factors (Hauvax, Lannoye, 1985; Rubin et al., ... Predominant bleaching of the long-wavelength fraction of chlorophyll provides evidence that oxidative reactions are located close to the reaction center of PSI. ...
... Основными целями и задачами Олимпиады школьников по прикладной математике и информатике факультета ВМК МГУ имени М. В. Ломоносова (далее ? ... В 2016 году Олимпиада будет проходить в два тура ? заочный Интернет-тур и очный тур. ... Форма и сроки проведения заочного Интернет-тура Олимпиады: . ... Сроки и время проведения заочного Интернет-тура Олимпиады:љ19 марта 2016 года 16:00 (время московское, GMT+3) . ... Время и место проведения очного тура Олимпиады: факультет ВМК МГУ, 16 апреля 2016 года . ...
... О КРУЖКАХ . ... МАТЕРИАЛЫ ЗАНЯТИЙ . 2-4 классы . ... МАЛЫЙ МЕХМАТ - ШКОЛЕ . ... Ответ Решение . ... Построим граф, в котором вершины будут обозначать шары, и две вершины будут соединены ребром, если соответствующие шары касаются. ... Но этого быть не может, так как в графе не может быть нечетное число вершин нечетной степени (см. решение задачи ?4 из занятия ?13). ... Среди 40 внешне одинаковых монет 2 фальшивые они легче, чем остальные и весят одинаково. ... На столе лежит 5 коробочек. ...
... This assumption is grounded in the classical theory of stationary turbulence in the limit of infinite Reynolds number (e.g. Corrsin, 1951). ... The ratio of diffusivities is obtained as a function of buoyancy Reynolds number Reb and of the density ratio R (the ratio of the contributions of heat and salt to the density stratification). ... The main results are in section 5, where potential energy components, scalar variances and turbulent diffusivities for the two scalars are examined. ...
[
Текст
]
Ссылки http://ocean.phys.msu.ru/courses/stathyd/2005%20Smyth%20et%20al.%2C%20Differential%20diffusion%20in%20breaking%20Kelvin-Helmholtz%20billows.pdf -- 2298.1 Кб -- 11.11.2009 Похожие документы
Аспирантура МГУ имени М.В.Ломоносова . ... Международная научная конференция школьников ?XVI Колмогоровские чтения? ... 3 Апр 2016 . ... МГУ . ... Конференция пройдет с 3 по 7 мая 2016 года на базе Cпециализированного учебно-научного центра МГУ имени М.В. Ломоносова при участии факультетов Московского государственного университета имени М.В. Ломоносова, Российской академии наук, Российской академии образования и Клуба выпускников ФМШ Колмогорова. ... XVI Колмогоровские чтения - Информационное письмо . ...
... Cтипендия имени Г.П. Кудрявцевой . О конкурсе . ... 25 сентября 2014 года на заседании Ученого совета геологического факультета МГУ имени . М.В. Ломоносова утверждено Положение о стипендии имени Г.П. Кудрявцевой .љ ... Принять участие в конкурсе могут студенты 3-4 курсов и магистранты 1-го года обучения геологического факультета геохимического отделения (геохимики), если они: . ... 20.02.2016 г. 03 марта 2016 года состоятся X юбилейные научные чтенияљимени Г.П. Кудрявцевой. ...
... Начало интереса к "новому" искусству (прерафаэлитам, французским символистам). ... Май. ... Решение М. С. Соловьева и В. Я. Брюсова печатать 2-ю "симфонию" с маркой издательства "Скорпион" под псевдонимом "Андрей Белый" (придуман М. С. Соловьевым). ... Воскресенье" на квартире Белого с участием Блока и Брюсова . ... Начало мая. ... Использованы автобиографические сочинения Андрея Белого и его рукописи справочно-регистрационного характера: "Материал к биографии" (1923) (РГАЛИ, ф. 53, оп. 2, ед. хр. ...
Заголовок тезисов доклада И.И. Иванов, П.П. Петров [1] Текст тезисов доклада объем текста 2000-5000 знаков (с пробелами), включая сноски и список литературы, если таковые имеются [1]. Ссылки внутри текста оформляются в форме послетекстовых примечаний (не в виде сносок), озаглавленных «Примечания» [2]; в тексте ссылка на примечание ставится в квадратные скобки [3]. ... Иванов И.И. Конференция как форма научно-образовательной деятельности. ... Концепция проведения конференций // Конференции и жизнь. ...
[
Текст
]
Ссылки http://old.teacher.msu.ru/upload/teacher/conf/conf2013/tezisy-shablon.doc -- 31.5 Кб -- 26.09.2013 Похожие документы
... There are corresponding results showing that the Poincare duals of certain totally ge odesic cycles, which we will call "special cycles", span a definite part (a refined Hodge component) of the cohomology of the locally symmetric spaces of standard arithmetic type associated to the orthogonal groups O(p, q). ... Math. ... KLM3] (with B. Leeb and M. Kapovich) The generalized triangle inequalities in symmetric spaces and buildings with applications to algebra, Memoirs of the AMS, Vol. ...
[
Текст
]
Ссылки http://www.dubrovinlab.msu.ru/files/Alltogether.pdf -- 334.8 Кб -- 15.09.2012
[
Текст
]
Ссылки http://dubrovinlab.msu.ru/files/Alltogether.pdf -- 334.8 Кб -- 15.09.2012 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Лев Петрович Феоктистов . Лев Петрович Феоктистов родился 14 февраля 1928 года в семье служащих. ... Исследования Л.П. Феоктистова позволили также создать малогабаритные артиллерийские ядерные заряды большой мощности. ... С 1988 года и до конца жизни Л.П. Феоктистов заведовал отделом лазерного термоядерного синтеза Отделения квантовой радиофизики Физического института им П.Н. Лебедева. ... 2004 Кафедра физики атомного ядра и квантовой теории столкновений . ...
... SDPfox - the software package for the prediction of functional specificity groups and amino acid residues that determine the specificity using MPA. ... Amino acid residues that determine differences in protein functional specificity and account for correct recognition of interaction partners, are usually thought to correspond to those positions of a protein multiple alignment, where the distribution of amino acids is closely associated with grouping of proteins by specificity. ...
JOURNAL OF APPLIED PHYSICS VOLUME 96, NUMBER 1 1 JULY 2004 Theoretical analysis of the synergism in the dielectric strength for SF6 у CF4 mixtures A. V. Larin ґ Laboratoire de Physico-Chimie Informatique, Facultes Universitaires Notre-Dame de la Paix, Rue de Bruxelles 61, B ... Calculated electron energy distribution function EEDF for the SF6 /CF4 mixture solid lines and a pure CF4 dashed lines or b pure SF6 dotted lines vs the electron energy under the same E / N values as given in Table IV. ...
... О кафедре . ... О профессорах кафедры . ... Квантовая теория . ... Курсовые работы для 2-го курса . ... Новости . ... Новости кафедры . ... Физики создали магнитный монополь, существование которого было предсказано более 80 лет назад. Это открытие важный шаг на пути обнаружения аналогичных естественных частиц, что было бы сравнимо с открытием электрона. ... Эти странные частицы, являющиеся своими собственными античастицами, были предсказаны в 1937 году, но до сих пор оставались чистой теорией. ...