... 13-Aug-2014 12:13 106K lk_20140815_0905.tar.. 15-Aug-2014 09:06 106K lk_20140901_0823.tar.. 01-Sep-2014 08:23 103K lk_20141016_1324.tar.. 16-Oct-2014 13:25 103K lk_20141211_1708.tar.. 11-Dec-2014 17:08 103K lk_20150430_0315.tar.. 30-Apr-2015 03:15 103K lk_20150430_0420.tar.. 30-Apr-2015 04:20 103K lk_20150818_1511.tar.. 18-Aug-2015 15:11 104K lk_20151113_1903.tar.. 13-Nov-2015 19:04 105K lk_20160314_0610.tar.. 14-Mar-2016 06:11 105K . ...

Еще в разделе: (Показать все результаты (>3) - scan.sai.msu.ru/ )

... The philosophical consequences of synergetics, the interdisciplinary theory of evolution and self-organization of complex systems, are being drawn in the paper. ... Key words: complex systems, evolution, nonlinearity, pre-determination, self-organization, soft management, structure-attractors, synergetics 1. ... The spectra of possible, `allowed' structures correspond to sets of the eigenfunctions of the nonlinear equations describing the evolutionary processes in the complex system. ...

Еще в разделе: (Показать все результаты (>9) - www.students.chemport.ru/ )

• тест ?1
• тест ?2 по английскому языку
• тест ?6 по английскому языку

... ECOLOGICAL COOPERATION" . ... Brjanskaja oblast, Dubrovskij rajon, Seshcha (village), School . Brjanskaja oblast, Djat'kovskij rajon, Bytosh (village), School . ... Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Borodino (village), School . Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Yardenikha (village), School . ... Moscow, Children's Ecological Center of the National Park "Losinyj Ostrov" - the coordinator of ecological work of 18 Korolev-town's schools . Moscow, School #222 . ...

Еще в разделе: (Показать все результаты (>11) - www.ecocoop.ru/ )

... proposals* are presented by multinational consortia of organisations/individuals Proposals are evaluated by independent experts All proposal coordinators receive an Evaluation Summary Report Funding follows successful evaluation, selection and negotiation of grant agreement * except certain Support actions ··· 2 Who can participate · Three independent legal entities from three different EU Member States or Associated countries (presently ... 19 Proposals and projects in FP7 3. ...

Еще в разделе: (Показать все результаты (>84) - www.msu.ru/ )

• Faculty of Soil Science
• Faculty of Mechanics and Mathematics
• FACULTY OF FINE AND PERFORMING ARTS

... Положение об олимпиаде . ... Отборочный этап . ... от Оргкомитет олимпиады школьников "Ломоносов" - Четверг, 25 Февраль 2016, 12:10 . ... от Оргкомитет олимпиады школьников "Ломоносов" - Среда, 3 Февраль 2016, 18:52 . ... от Оргкомитет олимпиады школьников "Ломоносов" - Понедельник, 1 Февраль 2016, 17:12 . ... Оргкомитет олимпиады школьников ?Ломоносов? приглашает вас к сотрудничеству с целью организации и проведения заключительного этапа Олимпиады на вашей базе по различным профилям. ...

Еще в разделе: (Показать все результаты (>3) - olymp.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• StructAlign help

Doklady Biological Sciences, Vol. 375. 2000, pp. ... GENERAL BIOLOGY Specific Structural Features of the Pectoral Arch and Phylogenetic Relations in Some Mammalian Taxa S. V. Fomin and V. S. Lobachev Presented by Academician I.A. Shilov March 6, 2000 Received March 6, 2000 Reorganization of the pectoral arch has played an important role in mammalian evolution. ... Thus, the formation of two types of pectoral arch in the modern families of Lagomorpha could only have occurred through divergence. ...

Еще в разделе: (Показать все результаты (>62) - vertebrata.bio.msu.ru/ )

• http://vertebrata.bio.msu.ru/Imprinting_on_native_pond_odour_in_the_pool_frog.pdf
• http://vertebrata.bio.msu.ru/Poster_Gatilov.pdf
• Student Reports at International Conferences

. Summary of experimental results . The light absorbing capacity of phytoplankton, estimated from Fo , and its photosynthetic activity (estimated as Fv/Fm ) are key characteristics of the primary processes of photosynthesis. We suggested a formula for calculation of the primary production of phytoplankton from these two characteristics and underwater irradiance. The probing data were used to plot vertical profiles of phytoplankton productivity in various regions of the Baltic, Norwegian, and South China

Еще в разделе: (Показать все результаты (>11) - www.biophys.msu.ru/ )

... Vol. ... Translated from Biofizika; Vol. ... CELL BIOPHYSICS Effects of Electric Field on Spatiotemporal Patterning in the Reaction-Diffusion System A. I. Lobanov-, T. Yu. ... Abstract-A model is proposed that describes electrodiffusion in the layer adjacent to the cell membrane. The model takes into account chemical reactions at the membrane, Coulomb interactions between particles, their random motion (diffusion), and the effect of an external electric field. ... BIOPHYSICS Vol. ...

Еще в разделе: (Показать все результаты (>38) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/PDF/3336.pdf
• http://library.biophys.msu.ru/PDF/3347.pdf
• http://library.biophys.msu.ru/PDF/3335.pdf

... Individual SELEX products, aptamers, are small molecules (40­100 nt) that have a unique three-dimensional structure, which provides for their specific and high-affinity binding to targets varying from low-molecular-weight ligands to proteins. ... Selection of aptamers binding with a target is the key step in SELEX, as aptamers account for only a small fraction of the initial library (one aptamer per 109 to 1013 molecules) [6]. ... Fourth, modification can increase the aptamer affinity for a target. ...

Еще в разделе: (Показать все результаты (>6) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/nar2004.pdf
• http://rnp-group.genebee.msu.su/pdfs/febsz.pdf
• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2002_1.pdf

... 2008-06-05 18:33 . ... 2011-04-27 14:10 . ... 2009-01-14 15:41 . ... 2013-01-09 13:38 . ... 2010-12-28 14:23 . ... Apache/2.4.10 (Debian) Server at npidb.belozersky.msu.ru Port 80 ...

Еще в разделе: (Показать все результаты (>92) - npidb.belozersky.msu.ru/ )

• Index of /data/html_scop
• Index of /data/pdb_new
• Index of /data/samples

Name Last modified Size Description . Parent Directory 28-Dec-2015 15:33 - nsv.dat 04-Feb-2016 15:51 1.6M nsv_pos.dat 04-Feb-2016 16:30 565k readme.txt 02-Dec-2015 18:16 15k ref.txt 16-Nov-2015 17:27 130k rem.txt 19-Oct-2015 17:50 151k .

Еще в разделе: (Показать все результаты (>126) - sai.msu.ru/ )

• Index of /groups/cluster/gcvs/gcvs/iv
• Index of /groups/cluster/gcvs/gcvs/iii
• Index of /groups/cluster/gcvs/gcvs/vol3

The 3 rd Autumn forum of volunteers in MGU. Last weekend the chemical faculty of MGU held the Autumn forum of volunteers from Russian organization "World4U". The university students and visitors from abroad discussed actual problems of science and life. ... Lectures after V. Vinogradov to be read at the philological department. ... Students of historical department of the Moscow State University are thinking over the possibility to create a Museum of substitutes for modern money. ...

Еще в разделе: (Показать все результаты (>13) - www.rlcentre.com/ )

• "ABOUT RUSSIAN" - news about Russian language and Russia

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>4) - sinp.msu.ru/ )

... О КАФЕДРЕ ? ... GENERAL INFORMATION ABOUT THE CHAIR . ... Кафедра ЮНЕСКО по изучению глобальных проблем и возникающих социальных и этических вызовов для больших городов и их населения на факультете глобальных процессов Московского государственного университета имени М.В. Ломоносова . ... Cоздание кафедры ЮНЕСКО на факультете глобальных процессов МГУ открыло новые возможности для научных исследований в области возникающих глобальных социальных и этических проблемљ и для их преподавания. ...

Еще в разделе: (Показать все результаты (>3) - unesco.fgp.msu.ru/ )

... ОТЧЕТЫ СТУДЕНТОВ О ПРАКТИКЕ В САО . Лето 2001 года . ... Гришатовой Юлии . ... Для определения лучевых скоростей, FWHM (полной ширины на половине максимума) и интенсивности линия He I 6678.15А описывалась гауссианой ( рис.1 ). ... create/icat {P1} ztsh*.bdf . execute/catalog @@ set_lambda {P2} . execute/catalog @@ timing {P2} . execute/catalog @@ phase {P2} . ... create/table {P1}.tbl . ... create/column {P1}.tbl fwhm . execute/catalog @@ add_rv_curve_point {P2} {P1}.tbl . ...

Еще в разделе: (Показать все результаты (>15) - heritage.sai.msu.ru/ )

... Программы обучения . ... Пропустить категории курсов . ... Пропустить новости . ... от Администратор ЦДО Ф/Ф МГУ - Понедельник 4 Август 2014, 09:53 . 04 августа 2014 года в Интеллектуальном центре ? ... Российские ВУЗы все чаще переходят на дистанционное обучение . ... ДИСТАНЦИОННЫЕ ПОДГОТОВИТЕЛЬНЫЕ КУРСЫ ФИЗИЧЕСКОГО ФАКУЛЬТЕТА МГУ ПО ФИЗИКЕ И МАТЕМАТИКЕ Пропустить Страницы ЦДО в социальных сетях . ... Центр дистанционного образвания физического факультета МГУ им. М.В. Ломоносова 2007-2012 . ...

Еще в разделе: (Показать все результаты (>53549) - distant.phys.msu.ru/ )

• Уведомление

... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...

Еще в разделе: (Показать все результаты (>2) - depni.sinp.msu.ru/ )

... The linguistic aspects of the model and the properties of the semantic dictionary ensuring the content analysis with compression of the text structure are considered. Our dictionary resources serve an instru- ment for building a multilevel textual semantic structure. ... Reason (A,B), where SemF(A) = SIT or a whole semantic formula; the same for SemF(B). ... Sem(SIT)R . ... Semantic Resources for Textual Content Compression // Fourth International Conference on Meaning-Text Theory (MTT'09). ...

Еще в разделе: (Показать все результаты (>4) - leontyeva.srcc.msu.ru/ )

... General ideas of classical game-theoretic analysis: Game in normal form (as a model of players interaction) -Several participants (players) - Several possible strategies for each player -Payoff functions Principle of Nash equilibrium (as a method to define agents strategies during their interaction) -Nash equilibrium is a basic concept of game theory. ... If is not an equilibrium then mutants with pure strategy that is a best reply to have grater payoff than the average payoff for the main...

Еще в разделе: (Показать все результаты (>19) - io.cmc.msu.ru/ )

• The Department of Operations Research
• Кафедра Исследования Операций