... Only by numerical simulation. ... moment T (K) Dipole moment (D) Experiment Other example: Diffusion constant 200 250 298 350 400 2.40 2.37 2.48 2.59 2.80 2.25 The Distribution functions: radial distribution function 1 g (r) = N t =1 j i N TS N pair ( r - rij ) The Distribution functions: radial distribution function CC def 2 Work mode ­ computer related 1) · Perform simulation , create trajectory file · Calculate properties timestep by timestep 2) · Perform ...

Еще в разделе: (Показать все результаты (>10) - www.elch.chem.msu.ru/ )

... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...

Еще в разделе: (Показать все результаты (>3) - www.ccl.msu.su/ )

... Likert-type scale response anchors. ... Level of Acceptability . ... Neutral . ... Level of Appropriateness . ... Level of Importance . ... Level of Agreement . ... Somewhat disagree . ... Somewhat agree . ... Never true . ... Rarely true . ... Sometimes but infrequently true . ... Sometimes true . ... Usually true . ... Always true . ... Somewhat true of me . ... Somewhat true of what I believe . ... Priority: . ... Somewhat priority . ... Priority Level . ... satisfied . ... Somewhat satisfied . ...

Еще в разделе: (Показать все результаты (>34) - tukachev.flogiston.ru/ )

• Результаты эксперимента в режиме реального времени

... Dear creators of the Bensons courses! First of all I would like to thank you for such a magnificent English course! ... Look, it's really much more interesting - to listen to a virtual book, to look through the pictures, let alone role-play! ... However, I'm very glad that I took up "Bensons" - the course has given me wonderful possibilities to learn more about English culture, to fill some gaps in my knowledge of English grammar and just to spend my time with great pleasure and benefit! ...

Еще в разделе: (Показать все результаты (>11) - anazarenko.ffl.msu.ru/ )

• Факультет иностранных языков МГУ. Центр Дистанционного обучения.

Научно-образовательный центр Геномного секвенирования МГУ . ... Sep 11, 2014, 9:17 AM . Yegor Bazykin attached NGS_supported_list.pdf to Результаты конкурса NGS-проектов . ... Yegor Bazykin deleted attachment NGS_supported_list.pdf from Результаты конкурса NGS-проектов . ... Yegor Bazykin edited Конкурс NGS-проектов . ... Yegor Bazykin created Результаты конкурса NGS-проектов . Jul 5, 2014, 2:53 AM . Yegor Bazykin updated polozhenie.pdf . ... Recent Site Activity | ...

Еще в разделе: (Показать все результаты (>2) - genseq.fbb.msu.ru/ )

... Carbamide . ... Moscowљ? ... URALCHEM and Stamicarbon will develop a new technology for urea production . URALCHEM, a leading Russian producer of nitrogen fertilizers, signed a joint technology development agreement for the synthesis of urea with Stamicarbon, the world's top developer and licensor of urea processes. ... Laboratory of Chemical Thermodynamics љwasљestablished by Prof. Adam V. Rakovsky (corresponding member of USSR Academy of Sciences) first as a "halurgy laboratory" in 1930. ...

Еще в разделе: (Показать все результаты (>7) - td.chem.msu.ru/ )

... В левой части открывшегося окна Group Policy найдите раздел Local Computer Policy | ... Windows Update . ... Дважды щелкните по строке Configure Automatic Updates , в открывшемся окне поставьте переключатель в положение Enabled. ... Задав настройки для параметра Configure Automatic Updates, щелкните Next Policy и в окне Specify intranet Microsoft update service location Properties поставьте переключатель в положение Enabled, а в обоих полях ввода текста обязательно введите http://wsus.chem.msu.ru . ...

Еще в разделе: (Показать все результаты (>2) - netadmin.chem.msu.ru/ )

• Как определить MAC-адрес узла

Cassa depositi e prestiti spa Long-Term Instruments for financing Infrastructure Franco Bassanini Chairman of Cassa Depositi e Prestiti Institute of the Russian Academy of Sciences September 22, 2010, Moscow Cassa depositi e prestiti spa Global capitalism and short-termism · The short-termism that characterized recent global capitalism had negative effects on the ...

Еще в разделе: (Показать все результаты (>11) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/Nekipelov_France_2010_Slides_Eng.pdf

LUT Summer School: www.lut.fi/summerschool summerschool@lut.fi Guide for Student Advisers Greetings from your colleagues at Lappeenranta University of Technology! ... With the wide-ranging selection of courses on-offer during the LUT Summer School we aim to both challenge and inspire students. ... Lappeenranta and LUT Lappeenranta is located some 220 km northeast of Finland's capital, and about 230 km northwest of St. Petersburg, Russia. ... The fee will be given on the LUT Summer School web pages. ...

Еще в разделе: (Показать все результаты (>2) - www.phys.msu.ru/ )

... О факультете . ... Master In Ecology . Master In Nanobiotechnology . ... Nanobiotechnology and Biophysics? is intended for prospective highly qualified professionals with in-depth knowledge in of modern biophysics, molecular biology and nanobiotechnology. ... The program is focused at problems of modern nanobiotechnology, biophysics and proteomics, and hence it consists of the two parts: lectures/seminars and laboratory work. ... Lectures / Practical . ... Биологический факультет МГУ . ...

Еще в разделе: (Показать все результаты (>4) - www.bio.msu.ru/ )

. Name . Last modified . Size . Description . about_center/ . 14-Sep-2013 14:31 . - . sections/ . 31-Oct-2007 14:46 . - . Apache/2.2.16 (Debian) Server at educenter.sinp.msu.ru Port 80

Еще в разделе: (Показать все результаты (>9) - educenter.sinp.msu.ru/ )

Международный учебно-научный лазерный центр МГУ им. М.В. Ломоносова . ... О МЛЦ МГУ . ... Абстракт: The current status of studies in the physics of entangled states of atomic systems Р an interdisciplinary field involving quantum optics, quantum information, and the foundations of quantum mechanicsРis reviewed. ... In the second part, experiments on the creation and detection of entangled states in atomic systems are discussed along with associated experimental proposals for their refinement. ...

Еще в разделе: (Показать все результаты (>39) - ilc.phys.msu.ru/ )

... Electronic journal Issue 4. 10 september 2004 Leigh E. Making Learning a Game Introduction. As a university lecturer I enjoy playing games with learning goals in mind. My students are all adults who work in many different roles. ... Their needs include learning how to design activities that will support acquisition of practical skills, extend personal understanding of emotional factors, and improve awareness of factors ­ such as economic, ecological and political aspects of society. ... Play. ...

Еще в разделе: (Показать все результаты (>7) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./vorontchuk.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./paliulis_chlivickas.pdf

ISSN 1560-3547, Regular and Chaotic Dynamics, 2015, Vol. ... The Dynamics and Control of a Spherical Robot with an Internal Omniwheel Platform Yury L. Karavaev1* and Alexander A. Kilin 1 2** M. T. Kalashnikov Izhevsk State Technical University, ul. ... The problem of control of spherical robot motion along an arbitrary tra jectory is solved within the framework of a kinematic mo del and a dynamic mo del. ... To describe the motion of a spherical robot, we consider three coordinate systems. ... Vol. ...

Еще в разделе: (Показать все результаты (>109) - ics.org.ru/ )

• Institute of Computer Sciences - Publications

... Measurement of the MASS detectors parameters with mass program January 24, 2015 [112707] . MASS/DIMM electronics. ... Turbina-core(D): Dimm User Guide. ... N.Shatsky, V.Kornilov, The revision of the MASS/DIMM star catalogue. ... О.Возякова, В.Корнилов, Н.Шатский, Новое программное обеспечение прибора MASS/DIMM. ... V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site. ...

Еще в разделе: (Показать все результаты (>21) - curl.sai.msu.ru/ )

... Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mechmath faculty admission resumed its work and is actively preparing for the new reception 2015! ... Read more about Schedule in June . ... The Dean of Mechanics and Mathematics Faculty, the head of the Department of Mathematical and Computer Analysis Methods, professor Vladimir Chubarikov ; . ... Read more about The Open Day . ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>4) - pk.math.msu.ru/ )

• IX Festival of Science | Mechmath admission for internetional students

Synthesis and Use of Humic Derivatives Covalently Bound to Silica Gel for Np(V) Sequestration I.V. Perminova , L.A. Karpiouk, N.S. Shcherbina*, S.A. Ponomarenko§, St.N. Kalmykov, and K. Hatfield Department of Chemistry, Lomonosov Moscow State University, Moscow 119992, Russia Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow 119991, Russia § Institute of Synthetic Polymer ... I.V. Perminova, et al. ...

Еще в разделе: (Показать все результаты (>101) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2010/2010-kazachkov-optimization.pdf
• http://www.mgumus.chem.msu.ru/publication/2010/2010-grigoryev-transhumus.pdf
• MGUMUS -- Researches

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Chemistry of Heterocyclic Compounds, Vol. ... 8, 1995 INSTRUCTIONAL TECHNIQUE IN HETEROCYCLIC CHEMISTRY COMPUTER ANIMATION: A NEW METHOD AND REPRESENTATION IN HETEROCYCLIC FOR TEACHING, OF KNOWLEDGE COMMUNICATION, ABOUT REACTIONS CHEMISTRY E. V. Babaev We propose the use of computer animation techniques .for representation of knowledge about organic reactions, in particular as applied to syntheses and transformations of heterocTcles. ... Let us briefly consider the capabilities of this program. ...

Еще в разделе: (Показать все результаты (>119) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/024e.pdf
• Dmitriy Mendeleev Online
• THE ALTERNATION RULE: AN OLD HEURISTIC PRINCIPLE OR A NEW CONSERVATION LAW

... DESCRIPTION General Catalog of Variable Stars (GCVS database) . ... Kholopov P.N., Samus N.N., Durlevich O.V., Kazarovets E.V., Kireeva N.N., Tsvetkova T.M., 1990, General Catalogue of Variable Stars, 4rd ed., vol.IV, Nauka, Moscow. Kholopov P.N., Samus N.N., Durlevich O.V., Kazarovets E.V., Kireeva N.N., Tsvetkova T.M., 1992, General Catalogue of Variable Stars, 4rd ed., vol.IV, Bull. ... Kazarovets E.V., Durlevich O.V. Editor-in-Chief Samus N.N., 1998, New Catalogue of Suspected Variable Stars. ...

Еще в разделе: (Показать все результаты (>79) - sai.msu.ru/ )

• General Catalogue of Variable Stars: Homepage.
• Index of /groups/cluster/gcvs/gcvs/nsv
• General Catalogue of Variable Stars: Vols I-III (the new electronic version).