... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

, JavaScript : ..-.. .. : .., .., .., Samsung Research & Development Institute, Russia W orld W ide W eb JavaScript, W eb-. Web-, («Internet of Things») Web- , JavaScript , . , . JavaScript . 17.00 18.30 507. 10 2014. , , : jsseminar@outlook.com

Еще в разделе: (Показать все результаты (>3) - master.cmc.msu.ru/ )

• http://master.cmc.msu.ru/files/Software_Protection.pdf

HOMEPAGES OF MUSCLE PEOPLE or GROUPS AROUND THE WORLD . ... King's College, London . Michael Ferenczi . Imperial College of Science, Technology & Medicine, London . ... Michael Reedy . ... London Muscle Series . ... European Biophysical Societies' Association . European Society for Muscle Research . ... Argonne National Laboratory, USA  . ... Daresbury Laboratory, UK . MUSCLE-RELATED PERIODICALS . Biophysical Journal . ... The Journal of Physiology . ...

Еще в разделе: (Показать все результаты (>6) - muscle.imec.msu.ru/ )

• BS Form

... Data . ... All links ] [ Models ] [ Space weather ] [ Research Institutions ] [ Data sources ] [ News sites ] [ Satellites ] [ Local library ] [ Education ] [ Journals ] [ Events ] . ... NSSDC Space Physics Models . ... Solar Influences Data analysis Center (Royal Observatory of Belgium) . ... Space Weather News Data Base . ... Space Weather Resources (NSSDC) . ... AAS Solar Planetary Division (AAS SPD) . ... Russian Space Science Internet . ... National Space Science Data Center (NSSDC) . ...

Еще в разделе: (Показать все результаты (>68) - smdc.sinp.msu.ru/ )

• NUCLEON Experiment
• RELEC - relativistic electrons
• Space monitoring data center

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>89) - scon155.phys.msu.su/ )

• The Physics of Semiconductors division of MSU
• Laboratory of Semiconductor Optoelectronics
• Theory of electronic properties of disordered semiconductors and systems with

... N.5, pp.592-597 (scanned PDF file, English version) . ... A.V.Shanin, Embedding formula for electromagnetic diffraction problem // Zapiski seminarov POMI, V.324, pp.247-261 (2001), in Russian, (PDF file, Russian version) (PDF file, English version) . ... PDF file) . ... Shanin A.V., Coordinate equations for the Laplace-Beltrami problem on a sphere with a cut // QJMAM, 2005 (58) 2, 1-20 The preprint versions of two previous papers have been sent to URSI contest: Paper 1, PDF file , Paper 2, PDF file ...

Еще в разделе: (Показать все результаты (>37) - acoustics.phys.msu.ru/ )

... Astronomy search engine . ... PhysicsWeb Home Page . ... Sternberg Astronomical Institute . ... Astro Space Center Home Page . ... Landau Institute for Theoretical Physics . ... Astronomy and Space Physics Dept of Kiev University . ... NATIONAL RADIO ASTRONOMY OBSERVATORY Home Page . University of Hawaii - Institute for Astronomy . ... Space Telescope Science Institute Home Page . ... Sky & Telescope: The Essential Magazine of Astronomy . ... Springer LINK - Physics Online Library . ... Home . ...

Еще в разделе: (Показать все результаты (>393) - astro.uni-altai.ru/ )

... You must have cookies enabled to log in to MediaWiki. ... Retrieved from " http://algcourse.cs.msu.su/teachwiki/index.php/Special:UserLogin " . Special page . 93.180.27.85 . Talk for this IP address . Log in . ... 1-й семестр 2015 г. Материалы по системе ejudge . ... Special pages . ... About MediaWiki . ...

Еще в разделе: (Показать все результаты (>2) - algcourse.cs.msu.su/ )

. Laboratory Head: L.K.Gladilin, tel: (+7 495) 939 3568 , fax: (+7 495) 939 3064 , . Сотрудники Лаборатории (LHPR staff) . Web-pages: . L.K.Gladilin , . V.I.Rud , . I.A.Korzhavina , . Information for our Guests . Справка о создании и первом периоде работы лаборатории, подготовленная в 1980 г. Research Activities: . Scientific Information Search Engines : inSPIRE , ScienceResearch , Google Scholar . Scientific Servers : Interactions , AIP , Elements , Scientific . Feedback: Last modified on March 1, 2016.

Еще в разделе: (Показать все результаты (>14) - lhe.sinp.msu.ru/ )

• L.Gladilin's address Page

... Leading Research Associate (MSU) . ... Graduated from the Moscow State University, 1960 . PhD, Moscow State University, 1970 . Doctor of Sciences, Moscow State University, 1995 . ... Type of Research: experiment . Research Interests: . ... Graduated from the Moscow Institute of Chemical Technology, 1954 . PhD, Moscow Institute of Chemical Technology, 1958 . Doctor of Sciences, Moscow Institute of Chemical Technology, 1981 . ... Type of Research: experiment, theory . ...

Еще в разделе: (Показать все результаты (>4) - newcryst.phys.msu.ru/ )

• Search of novel crystalline materials

Summary Progress Report 2010 ­ 2014 UNESCO Chair on Global Problems and Emerging Social and Ethical Challenges for Large Cities and Their Population at the Faculty of Global Processes of the Lomonosov Moscow State University Period of activity: September 2010 June 2014 Title of the Chair : UNESCO Chair on Global Problems and Emerging Social and Ethical ... Visit of UNESCO Director-General Irina Bokova at Moscow State University September 9, 2011. ...

Еще в разделе: (Показать все результаты (>130) - fgp.msu.ru/ )

• http://www.msu.ru/en/admissions/general-programs/docs/FACULTY%20OF%20GLOBAL%20STUDIES.pdf
• http://fgp.msu.ru/wp-content/uploads/2015/10/Programme_English-2.pdf

... Разработка и внедрение образовательных программ повышения квалификации специалистов в области инновационной деятельности . ... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 06/04/2016 . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... 27 марта 2016 года Московский государственный университет имени М.В.Ломоносова приглашает на весенний ДЕНЬ ОТКРЫТЫХ ДВЕРЕЙ . ... New technologies in gas chemistry . ...

Еще в разделе: (Показать все результаты (>5) - www.hsib.msu.ru/ )

... Society . ... Viktor Titovich Trofimov , professor, Department Chairman at the Faculty of Geology, Vice President of the Lomonosov Moscow State University . ... Ksenia Vsevolodovna Avilova , Candidate of Biological Sciences, senior research associate of the Faculty of Biology at the MSU . Aleksandr Sergeevich Alekseev , Doctor of Geological Mineralogical Sciences, professor at the Faculty of Geology at the MSU . ... 2015 Moscow Society of Naturalists . ...

Еще в разделе: (Показать все результаты (>4) - www.moip.msu.ru/ )

MOSCOW STATE UNIVERSITY INSTITUTE OF PROTEIN RESEARCH, RUSSIAN ACADEMY OF SCIENCES ИНСТИТУТ БЕЛКА The ribosome as a molecular machine: structure and functions. ... Phone: +7(4967)318425 E-mail: nikulin@vega.protres.ru Travel from Moscow: bus 359 from subway station "Yuzhnaya" Biological Faculty of Moscow State University: 119991 Moscow, Leninskie Gory 1, building 12. ...

Еще в разделе: (Показать все результаты (>9) - www.bio.msu.ru/ )

• The Second White Sea Molecular Zoology Summer School ? Биологический факультет
• Master In Ecology ? Биологический факультет МГУ
• Cеминар "Scientific Writing in English. Problems in writing up research: How to

... Department of Computational mathematics and cybernetics , Lomonosov Moscow State University . ... Thesis title "Machine learning approach for automatic performance tuning of parallel program", supervisor Dr. Nina N. Popova. ... High-performance computing, automatic performance tuning, machine learning algorithms, evolutionary and bio-inspired programming, parallel algorithms in VLSI design . ... Algorithms and framework for automatic selection and tuning parameters of parallel sparse linear solvers....

Еще в разделе: (Показать все результаты (>4) - angel.cmc.msu.ru/ )

Вы посетили: inv_engl.html . ... История кафедры . ... Visiting Professor at the University of Oslo, Norway, Oslo, November, 2010 . ... Visiting Professor at the University of Ljubljana, Slovenia, August, June 2010 . ... Visiting Professor at the University of Patras and the University of Athens, Greece, June-July 2009 . ... Visiting Professor at the University of Stockholm, Sweden, January ? ... staff/guterman/inv_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>17) - halgebra.math.msu.su/ )

• staff:guterman:conf_engl.html | Кафедра высшей алгебры
• staff:guterman:conf_rus.html | Кафедра высшей алгебры
• staff:guterman:activ_rus.html | Кафедра высшей алгебры

... Cell Research Online / CRO [not defined] . Common information . ... no information] . ... biology . Published by . ... Cell Research, . ... Institute Of Biochemistry And Cell Biology, . ... Page in Publisher . http://www.cell-research.com/ . ... http://www.cell-research.com/contents.. ...

Еще в разделе: (Показать все результаты (>453) - journals.genebee.msu.ru/ )

• JCatalog - Список журналов
• JCatalog journal list

... Academic Departments . ... Partners . ... All partners . ... The topic of the seminar is The future of media and communication policy research . ...

Еще в разделе: (Показать все результаты (>113) - www.journ.msu.ru/ )

• News :: Department of Journalism, M. V. Lomonosov Moscow State University <span
• Partners :: Department of Journalism, M. V. Lomonosov Moscow State University
• About :: Department of Journalism, M. V. Lomonosov Moscow State University

... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... Shmeleva Elena Vladimirovna . ... Research interests - strategic and corporate governance, culture of innovation, HSE-management, talent management, corporate social responsibility, quality management system of higher education. ... The head of more than 200 research projects. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>12) - hsmi.msu.ru/ )

Irena Lasiecka ( University of Virginia ) . Nikolai Melnikov (CEMI / MSU) . Mikhail Zelikin (MSU / Steklov Institute) . G. Avalos ( University of Nebraska , USA ) . V. Borisov (MSU, Moscow) . ... O. Emanouvilov ( Colorado State University , USA ) . A. Fursikov (MSU, Moscow) S. Hansen ( Iowa State University , USA ) R. Hildebrand ( Joseph Fourier University , France) V. Komornik ( University of Strassburg, France ) A. Kowalewski ( Institute of Automatics, Poland ) . ... Moscow) . ...

Еще в разделе: (Показать все результаты (>3) - oc.cs.msu.su/ )