... PhD thesis title: Gauge dependence of effective action in quantum gravity. ... Research fields of interest . Combustion: nonlinear development of the Darrieus-Landau instability of premixed flames, nonlinear flame stabilization and steady flame propagation, asymptotic methods, small gas expansion limit, non-perturbative description of curved flames, flame propagation in gravitational field, propagation of diffusion flames in counterflows. ... Gauge-independent effective gauge fields. ...

Еще в разделе: (Показать все результаты (>9) - theorphys.phys.msu.ru/ )

• Научный семинар 'Геометрия и физика'
• Междисциплинарный семинар 'Метафизика'

. РЕЙТИНГ СЛУХОВ . о проекте права пишите нам .

Еще в разделе: (Показать все результаты (>8) - www.niiss.ru/ )

Q: Recently I read a book called ?C14-CrashЃ by Christian Bloess and Hans-Ulrich Niemitz (there is a summary in German with figures on . ... Briefly, the authors claim that the majority of the original assumptions made by Libby for the radiocarbon . ... directly calculated from a C14 value." ... such fractions are used for calibrations and dating. ... used for radiocarbon calibration. ... important after atmosphere reservoir - upper ocean. ... radiocarbon content in the atmosphere. ...

Еще в разделе: (Показать все результаты (>112) - hbar.phys.msu.ru/ )

• Age Determinations by Radiocarbon Content: Checks with Samples of Known Age
• newtrev1.htm
• ИСТОРИЯ СТАНОВЛЕНИЯ НАУКИ И ТЕХНИКИ

International Symposium Biological Motility: New facts and hypotheses ================================================= Pushchino , Moscow region, Russia May 12-14, 2014 Chairman of Organizing Committee Prof. Zoya Podlubnaya Institute of Theoretical and Phone (4967)739269 Experimental Biophysics RAS Fax (4967)330553 Pushchino , Moscow region E-mail: motility2014@iteb.ru 142290, Russia Preliminary information Dear colleagues, The ... Deadline for sending abstracts is 1 of March 2014. ...

Еще в разделе: (Показать все результаты (>2) - cytol.bio.msu.ru/ )

... Under physiological conditions, nucleoside diphosphate kinase (EC 2.7.4.6, NDPK) catalyzes the reactions of nucleoside triphosphates synthesis from ATP and the respective nucleoside diphosphates. ... During the last years, we have studied properties and functions of NDPK in the outer compartment of rat liver mitochondria. ... Why did we decide to study NDPK of the outer compartment of rat liver mitochondria? ... T.Y. Lipskaya (2001) Biochemistry (Mosc), 66, 115 - 129. ...

Еще в разделе: (Показать все результаты (>39) - biochem.bio.msu.ru/ )

• Sulfated and sulfonated polymers are able to solubilize efficiently the protein
• Biochemistry Department of Moscow State University | About us

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...

Еще в разделе: (Показать все результаты (>7) - srd.sinp.msu.ru/ )

... Main results of different objects studying using scanning probe microscopy methods are 3-dimensional images of these objects usually. ... It gives significantly more convenient image processing, but photographic quality, common for electronic microscopy methods was lost. Information obtained with scanning probe microscope is represented in a computer as numbers in 2 dimensional matrix. ... Thus, every matrix value is represented by point of some colour on a rectangular image. ... Averaging data . ...

Еще в разделе: (Показать все результаты (>88) - www.spm.genebee.msu.ru/ )

• Igor Yaminsky's homepage
• FemtoScan Online FAQs
• Operating system driver

... БИБЛИОТЕКА НИИЯФ МГУ . ... Полный список журналов ELSEVIER и SpringerLink доступных в 2011 году . ... Электронные ресурсы НИИЯФ МГУ . ... Acta Physica Hungarica, New Series, Heavy Ion Physics . ... Applied Physics Letters . ... аннотации . ... Astrophysical Journal, Astrophysical Journal Letters, Astrophysical Journal Supplement series . ... Journal of Physical Chemistry A . ... The European Physical Journal - Applied Physics . ... The European Physical Journal E: Soft Matter and Biological Physics ...

210. About the CCOE at Lomonosov Moscow State University | CUDA Center of Excellence

211. http://polit.msu.ru/pub/2015_11_30/C2015.doc

212. YaB-100 - Participants

213. http://qi.phys.msu.ru/Katamadze/Katamadze%20CV.pdf

214. Workshop тАЬCosmic Ray Physics Large Scale Experiments at the Second Decade of

215. http://opts.phys.msu.ru/rus/fiber-laboratory.html

216. About Mathematics and Mechanics Faculty | Mechmath admission for internetional

217. http://lvk.cs.msu.su/~sveta/SDN_OpenFlow_controllers_lecture2.pdf

218. GCVS Research Group: History and Persons.

219. http://matematika.phys.msu.ru/files/seminar/189/Naidu_SPaTS_Presentation_MoscowStateUniversity_2012_06_23_Abstract+and+Biography.pdf

220. http://antares.sinp.msu.ru/docs/Anisotropy_2011Bamberg.pdf