... Department . ... Contacts . ... The department offices are at the 6th and 7th floor in the Lomonosov MSU 2nd educational building (Faculty of Computational Mathematics and Cybernetics): 714 (scientific secretary of the department), 615a (head of the department), 666, 717. ... CMC Faculty at Google Maps and Yandex.Maps . ... Scientific secretary of the department, Assoc. ... Deparment of the Automation for Scientific Research (ANI) . ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>10) - ani.cmc.msu.ru/ )

• Contact information

... Лаборатория теоретической биофизики . ... FRAP kinetics can be measured from image series directly with numpy libraries. ... Here we provide script that helps you to remove sample motion and obtain FRAP kinetics from image series with console script. ... Here oribl is a small image and _im is full image. ... Нет комментариев " Python script for processing FRAP image set " . ... Python script for processing FRAP image set . ... 2015 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>20) - erg.biophys.msu.ru/ )

• FRAP ERG Research Group: Лаборатория теоретической биофизики
• PyMol script for scanning potential energy surfaces ERG Research Group:
• Building and plotting Fukui function with FireFly and PyMol ERG Research Group:

... April 2, 1999 . Stars of NGC 206 . ... Explanation: Nestled within the dusty arms of the large spiral galaxy Andromeda (M31), the star cluster NGC 206 is one of the largest star forming regions known in our local group of galaxies. The beautiful bright blue stars of NGC 206 betray its youth - but close, systematic studies of variable stars in and around NGC 206 will also accurately reveal its distance. ... About APOD > . ...

Еще в разделе: (Показать все результаты (>17) - www.arcetri.astro.it/ )

• APOD: June 5, 1999 - Betelgeuse, Betelgeuse, Betelgeuse
• APOD: 2000 July 26 - Lingering Lunar Eclipse
• APOD: 2000 October 23 - Dwarf Elliptical Galaxy NGC 205 in the Local Group

... немецкий химик, член Берлинской Академии наук . Цирконий (лат. ... Известно пять природных изотопов циркония: 90 Zr (51,46%), 91 Zr (11,23%), 92 Zr (17,11%) 94 Zr (17,4%), 96 Zr (2,8%). В 1789 году немецкий химик М. Г. Клапрот в результате анализа минерала циркона выделил двуокись циркония Порошкообразный цирконий впервые был получен в 1824 году И. Берцелиусом, а пластичный - в 1925 году нидерландскими учеными А. ван Аркелом и И. де Буром при термической диссоциации иодидов циркония. ...

Еще в разделе: (Показать все результаты (>19) - www.students.chemport.ru/ )

• Страничка 12 группы Химического факультета МГУ им. М.В.Ломоносова
• Список слов, необходимых для сдачи экзамена по английскому
• Y ttrium 04

Physics and Chemistry of Solvated Electron Vladimir I. Feldman Department of Chemistry, Moscow State University, feldman@rc.chem.msu.ru utline · What is "solvated electron" ? Localization of excess electrons in condensed molecular media · Experimental detection and spectroscopic manifestations of hydrated electron · Solvated electrons in other molecular liquids and glasses · Models of solvated electron · Solvation dynamics: "digger" or "seeker" ? ... Emax (e-tr) > Emax (e-s) (E ~ 0.2­0.4 eV). ...

Еще в разделе: (Показать все результаты (>7) - www.elch.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/mole/lecture/probst.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

• ConClus

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>7) - mph.cmc.msu.ru/ )

• MPH-CMC-MSU

... The technique had been developed for calculating destruction of melting vitreous bodies in hypersonic gas flows taking into account the internal radiative transfer. ... The problem of flow in the chemically non-equilibrium boundary layer at a stagnation point of blunt body had been solved by the asymptotic method and formulas for the heat and diffusion fluxes to a surface of any catalycity had been obtained. ...

Еще в разделе: (Показать все результаты (>3) - lab106.imec.msu.ru/ )

Annu. ... Key Words stellar energy production, Nobel Prize, supernova, binary pairs s Abstract Astrophysics has been an important part of my personal and scientific life three times. ... Gamov suggested to one of his graduate students, Charles Critchfield, that he actually calculate the proton-proton reaction. ... In stars, the proton-proton reaction is usually followed by a chain of reactions with the end result of producing 4He. ... In 1938, they suggested energy production in stars. ...

Еще в разделе: (Показать все результаты (>153) - astro.uni-altai.ru/ )

• http://xray.sai.msu.ru/~polar/sci_rev/0811.html
• http://xray.sai.msu.ru/~polar/sci_rev/1007.html
• http://xray.sai.msu.ru/~polar/sci_rev/0608.html

... Сектор информатики и биофизики сложных систем . ... О секторе . ... Учебная работа сектора включает лекции, семинары, практические занятия по информатике и математическому моделированию в биологии, биофизике, экологии на всех 5-ти курсах обучения на кафедре биофизики. ... Диффузия и взаимодействие белков в биологических мембранах? консультанты Ризниченко Г.Ю. , Рубин А.Б. Рабочие семинары сектора информатики и биофизики сложных систем проходят по четвергам в 11:00 в аудитории 124 (компьютерный класс...

Еще в разделе: (Показать все результаты (>4) - www.biophys.msu.ru/ )

M obile A stronomical Sy stem of TE lescope- R obots MASTER-II Kislovodsk Lomonosov Moscow State University, Sternberg Astronomical Institute , Moscow Union "Optic" , Kislovodsk Solar Station Latitude = 43 o љ44'.767љN; Longitude = 42 o љ31'.417љE; Altitude = 2067љm MASTERљIIљ(8љsquareљdegress) + MASTERљVWF(VeryљWideљFieldљCameras (FOV=800 square degrees, Timeљresolutionљupљtoљ150љms, with unfiltered m_lim=14m on 5 sec. exposure, and ~10.5m with 0.15 sec) . ... 11h 38m 38.0s , -09d 59m 59s) . ...

212. http://antares.sinp.msu.ru/docs/INFN%20-%20NEMO.pdf

213. Catalogue of Space Storms