Копировать из putty текст в буфер обмена и обратно . ... Например, если неправильно ввели в интерактивном режиме программы EMBOSS какой-нибудь параметр и не хотите продолжать - зарубите ее, нажав Ctrl-C. Вызывать аналог far (Midnight Commander) прямо в putty . ... less . Искать в less какое-нибудь слово . ... Чтобы выйти из less, надо нажать q. Напоминаю также, что когда вы говорите "man что-то" или "tfm что-то", то текст руководства у вас тоже показывается в less, так что слеш можно использовать. ...
... Graduated in 1963 from the Faculty of Mechanics and Mathematics (Moscow State University). ... Honorary Doctor of Tokai University (Japan), Honorary Doctor of Istanbul University (Turkey), Honorary Doctor of Mongolian University , Honorary Doctor of Hanoi National University (Viet-Nam), Honorary Doctor of Byelorussian State University , Honorary Doctor of Yerevan University (Armenia), Honorary Doctor of Tashkent University (Uzbekistan), Honorary ...
... Department of Mathematical Physics . ... Springer: Журналы . Springer: Книги . ... Журнал Science . ... Журналы American Physical Society . ... Журналы NPG (Nature Publishing Group) . ... Журналы The American Mathematical Society . Журналы The Royal Society Publishing . ... The Royal Society Publishing (GreatBritain) . ... the Royal Society A: Mathematical, . ... the Royal Society B: Biological Sciences . Proceedings of the Royal Society A: Mathematical, Physical & Engineering Sciences . ...
... Faculty of Physics . ... Research Centers . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... E-MAIL ADDRESS: D.Khmelev@newton.cam.ac.uk . A new statistical method in the analysis of literary style for disputed authorship resolution is considered here. ... Consider a sequence of letter of text as a Markov chain. ... Suppose we take the logarithm of each probability, change a sign, and divide it by the length of control text; then each of the numbers obtained is called the relative empirical entropy . Relative empirical entropy is more convenient for computing than actual probabilities. ...
... UHECR SINP MSU . ... TUS . ... mini-EUSO (UV atmosphere) . News . UHECR news . TLE news . Lab's news . Publications . Publications UHECR . ... For students . Our students . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . JEM-EUSO Extreme Universe Space Observatory on the Japanese Experiment Module (JEM) of the International Space Station . ... JEM-EUSO is a new type of observatory that uses the earth's atmosphere as a detector. ...
S .. ... a database of structures of DNA-protein and RNA-protein complexes. ... a program for finding hydrophobic clusters in 3D structures of macromolecules . ... search of conserved hydrophobic clusters in aligned 3D structures of protein families . ... a program for analysis of multiple alignments . ... a program for automatic detection of aligned blocks in a multiple protein alignment. ... a program for detection of aligned blocks in a multiple alignment of sequences of PDB chains. ...
I was born on April 12, 1958, in Moscow, USSR, and I have a Russian nationality. I graduated the Lomonosov Moscow State University in 1981, obtained there my Ph.D.degree in 1984 (the topic of the dissertation: "Stellar populations and evolution of galaxies") and a degree of Doctor of Physical-Mathematical Sciences in 1994 (the dissertation "Stellar population of galactic nuclei"). Since 1984 I hold a permanent position at the Sternberg Astronomical Institute (Moscow). ...
... Process of Forming a Company - Discussion Question . ... You receive appropriate support from the University. Also University of Alberta statistics show that very few (less than 5%) technologies are successfully commercialized independently, whereas 50% of the technologies accepted by the University of Alberta are successfully commercialized. ...
Open Conference Systems . Conference Help . ... Conference Content Search . ... Conference Information . ... By Conference . ... Home > ICONO/LAT 2016 > Intl. Conf. on Coherent and Nonlinear Optics/Intl. Conf. on Lasers, Applications, and Technologies . The leading event in the area of quantum electronics, laser physics, photonics and their applications. ... ICONO/LAT 2016 will be held in Minsk, the capital and largest city in Belarus, The oldest mentions of Minsk date back to 1067. ...
Козлов А.Н. Кинетика ионизации и рекомбинации в канале плазменного ускорителя. Известия РАН, механика жидкости и газа. 2000, ? ... Kozlov A.N. Modeling of rotating flows in the plasma accelerator channel with longitudinal magnetic field. ... Kozlov A.N. Plasma flow peculiarities in accelerator channel with longitudinal magnetic field. ... Kozlov A.N., Zaborov A.M. Formation of the current attachments in plasma accelerator channel under influence of the longitudinal magnetic field. ...
... Bachelor Program . Master Program . ... The Department of Operations Research . ... researchers specialized in mathematical models and methods of economic regulations . ... possess a profound knowledge in the field of e со nometrics, risk theory, actuarial and financial mathematics, the theory of games, operations research, economic regulation on micro and macro levels . ... can use modern computer technologies in order to construct models and solve optimization problems . ... exam . ... test . ...
Monday, July 18th, 2011 . ... You are currently browsing the Лаборатория лазерной интерферометрии blog archives for July, 2011. О лаборатории . ... Наши публикации . Публикации до 2008 . ... Публикации за 2009 . Публикации за 2010 . Публикации за 2011 . Публикации за 2012 . ... January 2013 . ... June 2012 . ... January 2012 . ... July 2011 . June 2011 . ... January 2011 . ... July 2010 . June 2010 . ... Лаборатория лазерной интерферометрии is proudly powered by WordPress . ...
... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...
... http://www.univ-lorraine.fr/ . We have long-time collaboration with scientists from Laboratoire de Physique Moleculaire et des Collisions, Institut de Chimie, Physique et des Materiaux. 14 joint papers were published so far. ... http://www.uclouvain.be/ . ... There were published about 10 joint papers on mathematical aspects of few-body scattering theory in the case of Coulomb potentials. ... http://www.phys.msu.ru/ . ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...
... About the project . ... Biological information . As part of the project areas we will develop the scientific basis for the creation of infrastructure solutions and knowledge-based platforms for a comprehensive biodiversity study in Russia on the basis of genomic and storage technologies, analysis and exchange of data different types. ... Solution of problems set out in the project area will have the long-term effect in the various fields of science and engineering disciplines in the social sphere. ...