Curriculum Vitae . ... Lomonosov Moscow State University , Faculty of Computational Mathematics and Cybernetics . ... Lomonosov Moscow State University , Faculty of Physics . ... 2010 - till now . ... Research Scholar . ... Scholarship supporting perspective young scientists and teachers of Lomonosov Moscow State University who achieved significant results in teaching and research . ... Kurchatov Scholarship for excellent students of the Faculty of Physics, Lomonosov Moscow State University . ...
ЦЕНТР ТРАНСФЕРА ТЕХНОЛОГИЙ МГУ имени М.В.Ломоносова . ... Центр трансфера технологий МГУ совместно с кафедрой "Экономики инноваций" экономического факультета МГУ проводит цикл лекций "Коммерциализация результатов интеллектуальной деятельности и основы интеллектуальной собственности" (всего 5 лекций). ... Положение по организации работы в области создания, правовой охраны и использования результатов интеллектуальной деятельности в МГУ имени М.В.Ломоносова, утвержденное ректором МГУ 16 марта 2012 года. ...
О кафедре . ... Динамические задачи теории упругости . Динамика пластин и оболочек . ... Методы теории упругости . ... Нелинейная теория упругости . ... Пластины и оболочки . ... Теория и расчет оболочек тонкостенных летательных аппаратов . ... Теория упругости структурно-неоднородных тел . ... Уравнения изгиба пластин классическая линейная теория. ... Колебания пластин. ... Oscillation of plates . ... МГУ им. М.В.Ломоносова, механико-математический факультет, кафедра теории упругости . ...
XXIII ICTAM, 1924 August 2012, Beijing, China CASES OF INTEGRABILITY IN DYNAMICS OF A RIGID BODY INTERACTING WITH A RESISTANT MEDIUM Maxim V. Shamolin Institute of Mechanics, Lomonosov Moscow State University, Moscow, 119899, Russian Federation Summary The author discovers new integrable cases of the rigid body motion in a resisting medium, including those in the classical problem of motion of a spherical pendulum placed in the over-running medium flow. ...
... Русский English . Background . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Each of FBB students is to successfully complete and defend three yearly research projects, in bioinformatics, biochemistry, and bioengineering. ...
... Инновационная . структура МГУ . ... Обучение инновационному менеджменту . ... Нормативно-правовая база инновационной . деятельности . ... Process of Forming a Company . ... Finance for Start-Up . ... Building on the objectives of your current business plan, you schedule a comprehensive series of promotional activities for your company. ... 2005 Управление инновационной политики . и организации инновационной деятельности . МГУ им. М.В. Ломоносова . ...
... Course Name . ... Software Development for Computational Problems . ... Prof. Fedor S. Zaitsev . Data Analysis Methods . ... Computational Physics and Nanotechnology . ... Assoc. Prof. Igor N. Inovenkov . Mathematical Models for Dynamic Processes . ... Prof. Igor V. Zotov . ... One-Dimensional Problems of Mathematical Physics . ... Two-Dimensional Problems of Mathematical Physics . ... Maple for Mathematical Physics Problems . ... Source URL: http://ani.cs.msu.su/en/courses . ...
Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . ... ICES Journal of Marine Science: Journal du Conseil . ... Immunological Reviews . ... Industrial & Engineering Chemistry Research . ... International Journal of Impotence Research . ... International Journal of Management Reviews . ... International Journal of Public Opinion Research . ... International Journal of Urban and Regional Research . ... Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . ...
... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... БИБЛИОТЕКА НИИЯФ МГУ . ... Полный список журналов ELSEVIER и SpringerLink доступных в 2011 году . ... Электронные ресурсы НИИЯФ МГУ . ... Acta Physica Hungarica, New Series, Heavy Ion Physics . ... Applied Physics Letters . ... аннотации . ... Astrophysical Journal, Astrophysical Journal Letters, Astrophysical Journal Supplement series . ... Journal of Physical Chemistry A . ... The European Physical Journal - Applied Physics . ... The European Physical Journal E: Soft Matter and Biological Physics ...
Это новая версия каталога журналов, первоначально созданная Владимиром Мельгуновым. ... Packaging Technology and Science . Wiley Interscience ] . не определено] . ... International Palm Society ] . biology . ... PAMM - Proceedings in Applied Mathematics and Mechanics . ... Proceedings of Russian Academy of Sciences . ... Proceedings of the Royal Society of London Series B - Bio... [ the Royal Society ] . ... Proceedings of the Society for Experimental Biology and M... ... JCatalog | ...
THE ROLE OF DEVELOPING NATION TOWARDS COMBATING THE CYBER CRIME Abhishek Vaish and Satya Prakash, Indian Institute of Information Technology, Allahabad. ... Highlights on the recent trends: A report of Indian computer Emergency Response Team (CERTIN) shows that more than 2500 incidents were registered and handled in the year 2008. ... Others security incidents reported in the year 2004 was 4, in the year 2005 was 18, in the year 2006 was 17, in the year 2007 was 264 and in the year 2008 was 94. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/bayern2010/vaish_ea.pdf -- 652.4 Кб -- 02.04.2012 Похожие документы
Open Conference Systems . Conference Help . ... Conference Content Search . ... Conference Information . ... By Conference . ... Home > ICONO/LAT 2016 > Intl. Conf. on Coherent and Nonlinear Optics/Intl. Conf. on Lasers, Applications, and Technologies . The leading event in the area of quantum electronics, laser physics, photonics and their applications. ... ICONO/LAT 2016 will be held in Minsk, the capital and largest city in Belarus, The oldest mentions of Minsk date back to 1067. ...
Irena Lasiecka ( University of Virginia ) . Nikolai Melnikov (CEMI / MSU) . Mikhail Zelikin (MSU / Steklov Institute) . G. Avalos ( University of Nebraska , USA ) . V. Borisov (MSU, Moscow) . ... O. Emanouvilov ( Colorado State University , USA ) . A. Fursikov (MSU, Moscow) S. Hansen ( Iowa State University , USA ) R. Hildebrand ( Joseph Fourier University , France) V. Komornik ( University of Strassburg, France ) A. Kowalewski ( Institute of Automatics, Poland ) . ... Moscow) . ...
... О UNИX . ... ApacheWithModPython . ... Why Use mod_python . ... The sample configurations below are for a wiki instance called mywiki installed in a directory /var/www/moin/mywiki with the main MoinMoin installation installed in python's default site library path. ... Add a Location directive: <Location /mywiki> SetHandler python-program # Add the path of your wiki directory PythonPath "['/var/www/moin/mywiki'] + sys.path" PythonHandler MoinMoin.request.request_modpython::Request.run </Location> . ...
XXVIII General Assembly of the IAU, SPS15 Beijing, August 31, 2012 . N.N. Samus, S.V. Antipin "Variable Stars and Data-Intensive Astronomy" . During the 26th IAU General Assembly in Prague, the IAU Division V (Commissions 27 and 42) considered the future of variable-star catalogues. ... To discuss these problems and to look for their solutions, the IAU Commission 27, on behalf of the IAU Division V, created an informal working group, chaired by the GCVS editor, Dr. Nikolai Samus. ...