... REVIEWS Measurement and Physical Content of Quantum Information B. A. Grishanin and V. N. Zadkov Received January 15, 2002 Abstract--Basic quantum information measures involved in the information analysis of quantum systems are considered. ... But today, it has become possible to intentionally vary directly quantum states of elementary quantum systems. ... 9 2002 MEASUREMENT AND PHYSICAL CONTENT OF QUANTUM INFORMATION 935 its information-equivalent copy is at the input and output. ...

Еще в разделе: (Показать все результаты (>39) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/PRA-2000-62-32303-en.pdf
• http://qilab.phys.msu.ru/papers/LasPhys-2001-11(12)-en.pdf
• http://qilab.phys.msu.ru/papers/LasPhys-2000-10(6)-en.pdf

... Геология >> Геохимические науки | ... The Royal Institution London, England Formerly of Imperial Chemical Industries . ... NEW YORK AND LONDON 1964 . ... Чарльз Банн "Кристаллы. Их роль в науке и технике" . ...

Еще в разделе: (Показать все результаты (>20) - phys.web.ru/ )

... Помогите написать диплом, пожалуйста!!!! (9235 просмотра) . ... magdalina . Написано: 2009-01-08 12:52 . ... Может менять полностью область исследования и тему диплома? Подскажите, пожалуйста!! ... Vol 76(6), Dec 2008, 1015-1021.AbstractFew studies have examined predictors of weight regain after significant weight losses. ... Planning to lose weight: Randomized controlled trial of an implementation intention prompt to enhance weight reduction among overweight and obese women. ...

Еще в разделе: (Показать все результаты (>25) - www.flogiston.ru/ )

Stabilized Chaos in the Sitnikov Problem A.R . Dzhanoev1 , A. Loskutov2 , J.E. Howard3 , and M.A.F. Sґ 1 anju 1 2 3 Departamento de Fisica, Universidad Rey Juan Carlos, 28933 ... and Space Physics and Center for Integrated Plasma Studies, University of Colorado, Boulder, CO 80309, USA 1 Formulation of the Problem The Sitnikov problem consists of two equal masses M (called primaries) moving in circular or elliptic ... 64, 1196 (1990) Stabilized Chaos in the Sitnikov Problem 305 13. ...

Еще в разделе: (Показать все результаты (>29) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/loskutov/PDF/PHDK634.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/IJBC_ECG_analysis.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/Reprint_AMS.pdf

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... Letter of Application . ... Minilecture: How to organise information in the letter of application. When one applies for a position in a company, the letter of application cannot and should not contain all the information a prospective employer wants to know about you. ... If you know about a job opening within the company, refer directly to that position; if some person from that company told you of the job opening, you may begin the first paragraph by mentioning this person by name. ...

Еще в разделе: (Показать все результаты (>8) - anazarenko.ffl.msu.ru/ )

A.Nekipelov Modernization of Basic Research in Russia: Russian Academy of Sciences' (RAS) Vision Russia stands among the few countries of the world engaged in basic research along all its principal avenues. ... For example, in 2008 the total share of Candidates of Science engaged in Russian research organizations made 20.2% and that of Doctors of Science 6.7% whereas in RAS institutes the indicators were 43.0 and 19.0% respectively. ... The key link in basic research is a scientific laboratory. ...

Еще в разделе: (Показать все результаты (>10) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/RAS_Resolution.pdf
• http://www.mse-msu.ru/Bassanini_Mosca_rev4.pdf

THE RUSSIAN STYLE OF CIVIL PROCEDURE Dmitry Maleshin Reprinted from Emory International Law Review Volume 21, No. ... 26 See id. ... Another exceptional feature of the Russian civil procedure is the original status of judicial precedent as a source of Russian civil procedural law. ... 98 See OSCAR G. CHASE, LAW , CULTURE, AND RITUAL: DISPUTING SYSTEMS IN CROSS-CULTURAL CONTEXT 53-55 (2005); JAMES ET AL., supra note 6, at 309-10; THOMAS MAIN, GLOBAL ISSUES IN CIVIL PROCEDURE 5 (2006); Oscar G. Chase. ...

Еще в разделе: (Показать все результаты (>2) - www.law.msu.ru/ )

... Second-year students classes . Introduction to Linux . ... 32-bit Microcontroller Programming . ... In the given practical special course we address user techniques for working with Linux OS; we study the interface of the command line in great detail, methods of automation and batch processing, composition of scientific articles as well as the specifics of software design by using in-built toolkit. ... Use of console interface of the command line, automation (bash scripts) . ...

Еще в разделе: (Показать все результаты (>4) - engineering.phys.msu.ru/ )

... Registered participants . Symposium expenses . ... 14 European Symposium on . Gas Phase Electron Diffraction . ... Registered participants -  May 4, 2011 . ... Russia . ... Prof. Antipin . ... Prof. Arnason . ... Prof. Belyakov . ... Prof. Boldyrev . ... Prof. Campanelli . ... Prof. Christen . ... Prof. Dakkouri  . ... Prof. Dillen . ... Prof. Domenicano . ... Prof. Dorofeeva . ... Prof. D'yachkov . ... Prof. Girichev . ... Prof. Giricheva  . ... Prof. Godunov . ... Prof. Gorokhov . ...

Еще в разделе: (Показать все результаты (>2) - ged.chem.msu.ru/ )

... Отдел культуры древности . Отдел культуры и науки средневековой Европы . Отдел христианской культуры . Отдел русской культуры . ... Mellon Foundation / University of Chicago Dissertation Year Fellowship. ... Francois Furet Travel Grant (summer travel to France). ... FLAS (Title 6) fellowship for summer study of Turkish. ... DAAD Fellowship for summer study in Germany. ... Humanities and Social Sciences Research Grant Summer 1998. ... Soros Graduate Fellowship (grant #H2B70H), 1 year. ...

Еще в разделе: (Показать все результаты (>11) - imk.msu.ru/ )

• Институт мировой культуры МГУ

... Laboratory staff participate in the RFBR grant 14-01-00420-аА in 2014-2016. Laboratory staff participated in the RFBR grant 11-01-00523-аА in 2011-2013. ... A. Galstyan participated with poster . Poster . ... International Conference on Mathematical Modeling in Physical Sciences . ... International Conference on Mathematical Modeling in Physical Sciences, 2013, 1-5 September, Prague, Czech Republic . ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...

Еще в разделе: (Показать все результаты (>4) - lmmqsp.sinp.msu.ru/ )

XXI ) : 23.00.02 - , - 2015 « ». ... 1992. ­ 3. ­ . ... 2000; . ... 5; Beck U. World Risk Society. ... Cambridge, 1990; Luhmann N. Risk: A Sociological Theory. ... Modern Political Analysis. ... Risk Management and construction. ... New York: McGraw-Hill, 2000; Charles R. Kennedy (1988), "Political Risk Management: A Portfolio Planning Model," Business Horizons, 31(6); Carlson, Sunne. ... Published by Routledge, 2009. ­ 304 p.; Brink, Charlotte H. Measuring political risk: risks to foreign investment. ...

Еще в разделе: (Показать все результаты (>21) - www.spa.msu.ru/ )

• http://www.spa.msu.ru/uploads/files/nautchnaja_dejatelnost/fortin_abstract.pdf
• http://www.spa.msu.ru/uploads/files/h8dissertazionnii_sovet_d_501.001.27h8brh923.00.02__polititcheskie_instituti_prozessi_i_tehnologiih9/vasilieva_dissertaciya.pdf

2014 Titles.indd d Forum_1.indd Forum_1.in1 d 1 06.10.2014 22.10.2014 13:40 22.10.201419:55:48:08 13:40:08 Eighth International Forum «Partnership of State Authorities, Civil Society and the Business Community in Ensuring International Information Security» Ninth Scientific Conference of the International Information Security Research Consortium April 21­24, 2014 Garmisch-Partenkirchen, Munich, Germany Forum_1.indd Forum_1.indd 2 Titles.indd 2 22.10.2014 13:40 22.10.2014 19:55:48:11 06.10.2014 13:40:11

Еще в разделе: (Показать все результаты (>7) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf

... UHECR SINP MSU . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... According to existing estimations it can be a prominent source of ultra high energy cosmic rays (UHECR). ... In either case, the newly born magnetar is an attractive site for producing ultrahigh-energy cosmic rays (particles with individual energies exceeding 10 18 e V ; UHECRs). ... A new mechanism for the acceleration of ultra high energy cosmic rays (UHECR) is presented here. ...

Еще в разделе: (Показать все результаты (>2) - uhecr.sinp.msu.ru/ )

• Новости КЛПВЭ

Apache License Version 2.0, January 2004 http://www.apache.org/licenses/ TERMS AND CONDITIONS FOR USE, REPRODUCTION, AND DISTRIBUTION 1. ... Licensor" shall mean the copyright owner or entity authorized by the copyright owner that is granting the License. ... Work" shall mean the work of authorship, whether in Source or Object form, made available under the License, as indicated by a copyright notice that is included in or attached to the work (an example is provided in the Appendix below). ...

Еще в разделе: (Показать все результаты (>3) - neptun.sai.msu.ru/ )

• Apache 1.3 URL Rewriting Guide

Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

220. Ya.B. Zeldovich All-Moscow Seminar of Astrophysicists