... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...

Еще в разделе: (Показать все результаты (>12) - lcc.chem.msu.ru/ )

Alexander P. Seyranian . Institute of Mechanics , . Moscow State Lomonosov University , . ... Phone: (7495) 939 2039 . Fax: (7495) 939 0165, 939 2065 . ... My field of specialization are Stability Theory, Parametric Resonance, Gyroscopic Stabilization, Mechanics of Solids, Structural Optimization, Singularities and Bifurcations. ... Technical University of Denmark . Aalborg University, Denmark . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...

Еще в разделе: (Показать все результаты (>3) - seyranian.imec.msu.ru/ )

• Curriculum Vitae of Prof. Alexander P. Seyranian

... MATHEMATICAL AND SYSTEM BIOLOGY UDC 577.1 Membrane Profile-Based Probabilistic Method for Predicting Transmembrane Segments via Multiple Protein Sequence Alignment R. A. Sutormina and A. A. Mironova a b , b, c State Research Center GosNIIgenetika, Moscow, 117545 Russia; e-mail: sutor_ra@mail ... Bioinformatics, Moscow State University, Moscow, 119992 Russia Received January 25, 2006 Abstract--Prediction of transmembrane (TM) segments of amino ... Protein Sci. ... Proteins. ...

Еще в разделе: (Показать все результаты (>9) - storage.bioinf.fbb.msu.ru/ )

Communicating Through Art, L.Vershbow . ... But here I am, and as a designer, I will attempt to explain to you how I perceive art and design as a form of communication. Most of us think of art as the works that hang in museums and on the walls of our homes. ... But art, design and symbols, whether they are aesthetically pleasing or not, are all around us, and they help to guide us through the complexities of everyday society. ... Today I am a designer and creator of contemporary jewelry. ...

Еще в разделе: (Показать все результаты (>13) - suny.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

ЖУРНАЛ МОСКОВСКОЙ ПАТРИАРХИИ . ... OFFICIAL INFORMATION Statement by the Patriarch of Moscow and All Russia and the Holy Synod on the creation in Russia of Catholic diocese and an 'ecclesiastical province' // 3 || ... Statement by Patriarch Alexy II of Moscow and All Russia and the Holy Synod of the Russian Orthodox Church on the Situation in the Middle East // 5 || ... Visits by His Holiness Patriarch Alexy II His Holiness the Patriarch Visits Moscow Churches on Holy Saturday by S. Ganzhin // 6 || ...

Еще в разделе: (Показать все результаты (>29) - www.srcc.msu.ru/ )

MOSCOW STATE UNIVERSITY -- Faculty of Biology -- Department of Human Physiology -- . ... Our interest is the secret springs of work of a brain. How can a new idea be born in the brain if the physical environment remains constant? ... What mechanisms of the brain are broken in schizophrenia? ... For this purpose we create brain-computer interfaces (BCI) based on modern methods of computational electroencephalography. ... Department of Human Physiology . ... Former Visitors . ... Former students . ...

Еще в разделе: (Показать все результаты (>65) - brain.bio.msu.ru/ )

• Alexander Zhigalov

L omonosov Moscow State University (MSU) is the oldest University in Russia. ... Its head had become Professor Petr Ivanovich Strakhov (1757?1813) who played an important role for Physics progress at Moscow University. ... In May 1805, the University Board elected Prof. Strakhov Provost of Moscow State University. ... T o honor his contribution into science development Professor Lebedev was nominated to the Nobel Prize. ... In 1933 the Faculty of Physics was established in Moscow State University. ...

Еще в разделе: (Показать все результаты (>36) - foroff.phys.msu.ru/ )

• Postdoctoral training (Neutronography)
• Конференции, в которых наша группа принимает участие

Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...

Еще в разделе: (Показать все результаты (>2) - tepa2012.sinp.msu.ru/ )

Cassa depositi e prestiti spa Long-Term Instruments for financing Infrastructure Franco Bassanini Chairman of Cassa Depositi e Prestiti Institute of the Russian Academy of Sciences September 22, 2010, Moscow Cassa depositi e prestiti spa Global capitalism and short-termism · The short-termism that characterized recent global capitalism had negative effects on the ...

Еще в разделе: (Показать все результаты (>16) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/Nekipelov_France_2010_Slides_Eng.pdf

... Conferences . ... This conference is orientated towards academic and engineering experts in nonlinear dynamics, nonholonomic mechanics, classical and applied mechanics, systems with friction, biomechanics and related elds, with the focus on the cutting-edge theoretical research and the interaction between theory and practice. ... We will publish proceedings of the conference as a special issue of the journal Regular and Chaotic Dynamics. ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>105) - ics.org.ru/ )

• Institute of Computer Sciences - Events

... Научный календарь МГУ Научная жизнь на ФГУ Конференции Научные семинары Международная конференция ФГУ International Conference Молодым ученым Электронные ресурсы Список полнотекстовых баз данных (журналы) Список полнотекстовых баз данных (книги) Список реферативных баз данных Материалы международных конференций Архив мероприятий Конференции Научные семинары Круглые столы Презентации Международная конференция ФГУ Фестиваль науки Международное сотрудничество . ... Agricultural and Biological Sciences ...

Еще в разделе: (Показать все результаты (>44) - www.spa.msu.ru/ )

О НЕУСТОЙЧИВОСТИ СХОДЯЩИХСЯ УДАРНЫХ ВОЛН ПОЛИГОНАЛЬНОЙ ФОРМЫ А.В. Конюхов, А.П. Лихачев Объединенный институт высоких температур РАН, Москва Как известно [1], сходящиеся цилиндрические (сферические) ударные волны неустойчивы по отношению к потере пространственной симметрии с тенденцией к возникновению полигональной (полиэдральной) формы. ... Whitham, G. B., 1974 Linear and Non-linear Waves. ... Schwendeman, D. W., Whitham, G. B. On converging shock waves // Proc. R. Soc. ...

Еще в разделе: (Показать все результаты (>17) - hit-conf.imec.msu.ru/ )

Международный учебно-научный лазерный центр МГУ им. М.В. Ломоносова . ... О МЛЦ МГУ . ... Абстракт: The current status of studies in the physics of entangled states of atomic systems Р an interdisciplinary field involving quantum optics, quantum information, and the foundations of quantum mechanicsРis reviewed. ... In the second part, experiments on the creation and detection of entangled states in atomic systems are discussed along with associated experimental proposals for their refinement. ...

Еще в разделе: (Показать все результаты (>699) - ilc.phys.msu.ru/ )

• Publication
• Conference