Date: Mon, 1 Jul 1996 16:03:06 -0700 (PDT) From: Alexei Kosut <akosut@organic.com> To: Apache Group Subject: Re: keepalive and windoze Good news and good news (of a sort).. I was able to snag a Windows 95 machine here at Organic, and tried out some things: 1) On Netscape 3.0b4, I was able to reproduce the bug, each and every time. ... Alexei Kosut <akosut@organic.com> The Apache HTTP Server http://www.nueva.pvt.k12.ca.us/~akosut/ http://www.apache.org/ . ...

Еще в разделе: (Показать все результаты (>75) - neptun.sai.msu.ru/ )

• Issues Regarding DNS and Apache
• Custom error responses
• Apache HTTP Server Project

... Nonlinear optics of ionized mediums . Fiber lasers . ... Emergence of powerful laser systems, being able to deliver powerful ultrashort light pulses, allows one to investigate and exploit new class of nonlinear-optical phenomena, based on the media ionization, when the electrons are released by strong electromagnetic field directly or by collision of an atom with another electron accelerated in the field. ... Ultrafast optical switching of an ionized medium by interfering ultrashort laser pulses. ...

Еще в разделе: (Показать все результаты (>46) - photonicslab.phys.msu.ru/ )

... Petrakov Director of the Market Problems Institute, Russian Academy of Sciences Secretary: Professor Elena N. Veduta, School of Public Administration , Lomonosov Moscow State University Alexandrov, Dmitry ( Russia , Moscow ) ­ General Theory of Economic Growth and Models of National Economic Development Antonova, Victoria ( Russia , Moscow ) ­ Democratization of Economic Life as the Basis of Sustainable ...

Еще в разделе: (Показать все результаты (>61) - www.spa.msu.ru/ )

• http://www.spa.msu.ru/uploads/files/konferenzii/_program_conference_2013_eng.pdf
• Содержание выпусков

Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

Еще в разделе: (Показать все результаты (>10) - compmech.math.msu.su/ )

• Список публикаций - А. Н. Козлова - Кафедра вычислительной механики

... site navigation | footer (site information) . IChO-2007 Participation Problems IChO RUSSIA Sponsors search . ... Moscow-1996 | ... Chemistry Department | ... Homepages of National Competitions Other International Science Olympiads Previous IChO's Miscellaneous Chemistry sites . ... Some fresh information is available. A letter from the President of 39th IChO . ... Information about post-Olympiad tour is now available . ... Information about guides of 39th IChO is now available. ...

Еще в разделе: (Показать все результаты (>3) - icho39.chem.msu.ru/ )

Studying at MU Programs and degrees . ... Moscow State University provides a wide range educational services and educational programmes. ... International students are offered Bachelour (4 years full time) and Master programmes (2 years full time). A number of our faculties train both domestic and international students according to Bachelour and Master programmes with granting Bachelour and Master diplomas. ... Please, contact International Students Office for information on the topics offered. ...

Еще в разделе: (Показать все результаты (>7) - www.ied.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

... THE TIME HAS COME FOR "THUNDER BOOKS" . ... You may have forgotten what a thunder book is, or maybe you didn't ever use that name. ... It is a handy reference to those things you need to know about soils and how they behave. ... Well, if you knew how to use them as pages in a thunder book it would surely be a good start, but you need something uniquely yours. ... It has always been my belief that the mission of a soil survey is to help people understand and wisely use soil resources. ... Good read. ...

Еще в разделе: (Показать все результаты (>5) - www.paleopedology.msu.ru/ )

The Laboratory of the Historical Information Science . ... The historical information science laboratory was founded within the structure of the source studies department on 8 December 1995 for the purpose of fulfilling the decision of the academic council of the History Faculty of 4 October 1991 about the transformation of a group for the application of mathematic methods and mainframes in historical research in the laboratory of historical information sciences. ... Senior laboratory assistant (2) . ...

Еще в разделе: (Показать все результаты (>21) - www.hist.msu.ru/ )

• Instrumenta
• Textbooks and teaching aids

... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...

Еще в разделе: (Показать все результаты (>4) - depni.sinp.msu.ru/ )

Кафедра высокопроизводительных вычислений МГУ . Главная . ... Главной задачей кафедры является организация и осуществление на высоком уровне учебно-воспитательной работы по подготовке специалистов высокой профессиональной квалификации по высокопроизводительным вычислениям на многопроцессорных ЭВМ из числа студентов 2-5 курсов механико-математического факультета , физического факультета , факультета вычислительной математики и кибернетики, химического факультета и других факультетов ...

Еще в разделе: (Показать все результаты (>7) - hpcdep.msu.ru/ )

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Partners . ... All partners . ... During the round table, NAMMI and Lomonosov Moscow State University were represented by Sergey Smirnov, associate professor of the Faculty of Journalism of Lomonosov Moscow State University. ... 1999-2014 Faculty of Journalism, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>167) - www.journ.msu.ru/ )

• Periodical Press :: Department of Journalism, M. V. Lomonosov Moscow State

Mechmath admission for internetional students . Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mathematics and Mechanics Faculty was created 1 May 1933 with a recovery of the faculty system inљ Lomonosov MSU . ... The faculty prepares high level experts of wide areas of Mathematics, Mechanics and Applying Mathematics , possessing theoretical knowledge and a technique of scientific experiment . ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>6) - pk.math.msu.ru/ )

• Mechmath admission for internetional students

A.A. Mailybaev and A.P. Seyranian , . Multiparameter Stability Problems. Theory and Applications in Mechanics , . ... A.P. Seyranian and I. Elishakoff , eds. Modern Problems of Structural Stability , . ... Structural Optimization under Stability and Vibration Constraints , . ... Stability and Catastrophes of Vibrating Systems Depending on Parameters . ... Evan- Ivanowski R.M., eds ), 1993, DE- Vol . ... Optimization. ... System optimization by oscillation and stability criteria . ...

Еще в разделе: (Показать все результаты (>4) - seyranian.imec.msu.ru/ )

• Curriculum Vitae of Prof. Alexander P. Seyranian

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>65) - mph.cmc.msu.ru/ )

• MPH-CMC-MSU

Anisotropy of Cosmic Rays. Origins, experiments, data analysis problems & methods. ... ANTARES problems and methods. ... 2D» experiments Name Tibet Air Shower Array Position 90.522o E, 30.102o N; 4300 m above sea level 30.11 N, 4300m a.s.l. Gran Sasso, 2000m Caucasus, 1700m (40deg N, 113 deg W), atmospheric depth of 860 gm/cm2 Energy 4,6.2,12,50, 300 TeV Gamma /CR mix Time 1997-1999 TibetII, 1999-2001 TibetIII (bigger HD array). 4 years 1 year Statistics 7x109 in ~1000 days Rate Ang. ...

Еще в разделе: (Показать все результаты (>21) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/seminar/Kulikovskiy.pdf
• http://antares.sinp.msu.ru/docs/Ershova%20-%20Acoustic%20field%20eng.pdf
• http://antares.sinp.msu.ru/docs/NIMA.pdf

... UHECR SINP MSU . ... News . UHECR news . TLE news . Lab's news . ... Publications UHECR . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... Using the analytic modeling of the electromagnetic cascades compared with more precise numerical simulations we describe the physical properties of electromagnetic cascades developing in the universe on CMB and EBL background radiations. ... The new feature of the analysis is " E max rule". ... all news . ...

Еще в разделе: (Показать все результаты (>43) - uhecr.sinp.msu.ru/ )

• TLE news
• UHECR news
• Similarity analysis of the streamer zone of Blue Jets

... The software models the dynamics of RNA secondary structure by the means of kinetic analysis of folding transitions of a growing RNA molecule. The result of the modeling is a kinetic ensemble, i.e. a collection of RNA structures that are endowed with probabilities, which depend on time. ... 19, Moscow, 127994, Russia. ... Danilova, L.V., Pervouchine, D.D., Favorov, A.V., Mironov, A.A. (2006) RNAKinetics: a web server that models secondary structure kinetics of an elongating RNA. ...

Еще в разделе: (Показать все результаты (>8) - bioinf.fbb.msu.ru/ )

220. http://scan.sai.msu.ru/lk/