... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

... Veselovsky, V.A., Djanumov D.A. The use of biophysical methods in the study of adaptive reactions of plants, in connection with the problem of resistance. ... Kulaeva, O.N., Mikulovich T.P., Veselova, T.V., Veselovsky, V.A., Kukina, I.M., Klyueva N.Yu. ... Veselovsky, V.A., Veselova T.V . ... Nauka, Moscow (in Russian).1990. 200 p. Veselova T.V., Veselovsky V.A., Chernavsky D.S. Stress of Plant: A Biophysical Approach. ... Veselova T.V., Veselovsky V.A. Photosynthesis and stress of plant cells. ...

Еще в разделе: (Показать все результаты (>9) - biophys.msu.ru/ )

• Photo-induced delayed luminescence

Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

Еще в разделе: (Показать все результаты (>5) - compmech.math.msu.su/ )

• Список публикаций - А. Н. Козлова - Кафедра вычислительной механики

... hall in front of room 01, MSU, Main Building . ... room 01, MSU, Main Building . ... Silvia Chelala (Empire State College, State University of New York, Old Westbury, New York, USA) Designing and Teaching Introductory Spanish as a Foreign Language at a Distance . ... FFL, recreation hall, 3rd floor . ... FFL, room 519 . ... FFL, room 501 . ... FFL, . room 107-108 . ... Internet-Supported Teaching . ... FFL, room 106 . ... FFL, room 416 . ... FFL, room 420 . ... FFL, room 210 . ...

Еще в разделе: (Показать все результаты (>12) - anazarenko.ffl.msu.ru/ )

• Дистанционные курсы

DOI: 10.7256/2222-1972.2014.5.14682 doi « »: ( ) : . ... 526 © NOTA BENE ( «-») « » XI ., ... 527 © NOTA BENE ( «-») : 5 (23) · 2014 DOI: 10.7256/2222-1972.2014.5.14682 . ... XVI­XVIII . ... NOTA BENE ( «-») DOI: 10.7256/2222-1972.2014.5.14682 , [1, 7]. ... 529 © NOTA BENE ( «-») : 5 (23) · 2014 DOI: 10.7256/2222-1972.2014.5.14682 ­ , : « , " "». ... NOTA BENE ( «-») DOI: 10.7256/2222-1972.2014.5.14682 , « » [14, 155]. ... NOTA BENE ( «-») 533 : 5 (23) · 2014 DOI: 10.7256/2222-1972.2014.5.14682 27. ...

Еще в разделе: (Показать все результаты (>11) - www.hist.msu.ru/ )

• Instrumenta
• Editions

... PhDi . ... SOFTWARE PACKAGE FOR CALCULATIONS OF PHASE DIAGRAMS . elaborated and developed by laboratory scientists) . The software package contains a database of thermodynamic properties for about 200 systems and a software based on a so called convex hulls approach. ... binary systems in coordinates Temperature - Composition at fixed pressure and Pressure ? ... Colloquium on 24.12.12 20 Dec 2012 . ... Colloquium on 23.11.12 22 Nov 2012 . ... Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>9) - td.chem.msu.ru/ )

• Colloquium on 10.04.08 Laboratory of Chemical Thermodynamics

. JCatalog | Start | Links .

Еще в разделе: (Показать все результаты (>25) - journals.genebee.msu.ru/ )

• JCatalog journal list

... Studies of the Substorm on March 12, 1991: 1. ... The detailed space-time structure of the disturbance and the relation of the processes of growth phase and beginning of the expansion to the fluxes of auroral ions are studied in the first part of the paper. ... Fig. ... The pressure of low-energy ions of CPS grows with the beginning of the growth phase, transfers the plasma parameter into the region > 1, and after the beginning of the expansion phase the contribution of low-energy ions decreases. ...

Еще в разделе: (Показать все результаты (>96) - www.kosmofizika.ru/ )

• http://www.kosmofizika.ru/model/obrazec.doc
• INTERMAGNET - Magnetic Observatories (IMOS)
• SAMNET Magnetometers

Создание и оценка цифровых моделей рельефа высокой точности для урбанизированных территорий на основе цифровой картограф. продукции. Creating and evaluating high resolution DEM's for an urban environment from digital cartographic products / Carter J. R., Tripathy D. // 21 International Cartographic Conference "Cartographic Renaissance", Durban , 10-16 Aug., 2003. ... Durban, 2003, 10-16 Aug., ... С. 1851-1858. ...

Еще в разделе: (Показать все результаты (>18) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=20&from=&ref_ind=0312001032

. # ....... # S ....... S T ..... E R . Q U E . C N ..... T C ....... U # ....... R E ..... E S . S .

Еще в разделе: (Показать все результаты (>6941) - mouse.belozersky.msu.ru/ )

• NPG-explorer

... We discuss the calculation of the d.c. conductivity of granular metals on the insulating side of the metal--insulator transition. The granular structure is represented by a fractal percolation cluster and the problem of virtual tunneling-assisted conductivity is shown to be related to estimating the number of minimal paths for the problem of chemical distance metric on the fractal. ...

Еще в разделе: (Показать все результаты (>72) - scon155.phys.msu.su/ )

• Photoelectric phenomena and metastable states in amorphous semiconductors
• Theory of electronic properties of disordered semiconductors and systems with
• Physics of Semiconductors division: List of courses

... There are corresponding results showing that the Poincare duals of certain totally ge odesic cycles, which we will call "special cycles", span a definite part (a refined Hodge component) of the cohomology of the locally symmetric spaces of standard arithmetic type associated to the orthogonal groups O(p, q). ... Math. ... KLM3] (with B. Leeb and M. Kapovich) The generalized triangle inequalities in symmetric spaces and buildings with applications to algebra, Memoirs of the AMS, Vol. ...

Еще в разделе: (Показать все результаты (>2) - dubrovinlab.msu.ru/ )

• Лаборатория геометрических методов математической физики.

... The Informativeness of Coherence Analysis in EEG Studies A. P. Kulaichev UDC 612.821.6 Translated from Zhurnal Vysshei Nervnoi Deyatel'nosti imeni I. P. Pavlova, Vol. ... KEY WORDS: coherence, spectral analysis, EEG non-stationarity, amplitude modulation. ... In particular, the two fundamental differences between EEG signals and most other physical signals are not considered: a) fundamental non-stationarity; b) amplitude modulation at all frequency ranges. ... Coherence in technical addenda. ...

Еще в разделе: (Показать все результаты (>16) - www.protein.bio.msu.ru/ )

... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...

215. MASTER-II Kislovodsk