... hall in front of room 01, MSU, Main Building . ... room 01, MSU, Main Building . ... Silvia Chelala (Empire State College, State University of New York, Old Westbury, New York, USA) Designing and Teaching Introductory Spanish as a Foreign Language at a Distance . ... FFL, recreation hall, 3rd floor . ... FFL, room 519 . ... FFL, room 501 . ... FFL, . room 107-108 . ... Internet-Supported Teaching . ... FFL, room 106 . ... FFL, room 416 . ... FFL, room 420 . ... FFL, room 210 . ...
Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...
... Next Routine] [List of Routines] NAME: ADD_HEADER PURPOSE: addition information from FITS-headers MPFS-frames DESCRIPTION: The function computes the total exposure, mean value zenit distance and modified FITS header CALLING SEQUENCE: Result =ADD_HEADER( headers ) CATEGORY: reduction MPFS-data INPUTS: Headers = String array FITS-headers from the MPFS data OUTPUTS: Header = String array containing the header from the FITS file. ... OPTIONAL INPUT KEYWORD PARAMETERS: BEFORE = Keyword string name. ...
General Information . ... The conference is organized by the Sternberg Astronomical Institute (SAI) of Moscow University and the IAU Working group "Site-testing Instruments" . ... Use of site data in telescope operation and adaptive optics. ... Recent conferences on this subject (2007, 2008) demonstrated great interest of the community, hence the need for a new meeting. ... Unlike previous recent conferences, this meeting will cover all aspects of site monitoring for optical/IR astronomy. ...
Doxyfile 1.4.6-NO # This file describes the settings to be used by the documentation system # doxygen (www.doxygen.org) for a project # # All text after a hash (#) is considered a comment and will be ignored # The format is: # TAG = value [value, .. ... USE_WINDOWS_ENCODING = YES # If the BRIEF_MEMBER_DESC tag is set to YES (the default) Doxygen will # include brief member descriptions after the members that are listed in # the file and class documentation (similar to JavaDoc). ... The default is NO. ...
Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...
... M.V.Lomonosov Moscow State University . ... Physicists from Lomonosov Moscow State University studied the dynamics of multiple cavitation bubbles excited by a fs laser superfilament and developed a new approach for their control by laser pulse energy and external focusing. For the first time an innovative method of controlling the dynamics of cavitation bubbles excited by the distributed laser-plasma source (filament) was demonstrated. ... 119991, Moscow, . ...
Apache2 Ubuntu Default Page . It works! This is the default welcome page used to test the correct operation of the Apache2 server after installation on Ubuntu systems. ... Ubuntu's Apache2 default configuration is different from the upstream default configuration, and split into several files optimized for interaction with Ubuntu tools. ... The configuration layout for an Apache2 web server installation on Ubuntu systems is as follows: /etc/apache2/ |-- apache2.conf | ... Document Roots . ...
... Carbamide . ... Moscowљ? ... URALCHEM and Stamicarbon will develop a new technology for urea production . URALCHEM, a leading Russian producer of nitrogen fertilizers, signed a joint technology development agreement for the synthesis of urea with Stamicarbon, the world's top developer and licensor of urea processes. ... Laboratory of Chemical Thermodynamics љwasљestablished by Prof. Adam V. Rakovsky (corresponding member of USSR Academy of Sciences) first as a "halurgy laboratory" in 1930. ...
... Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mechmath faculty admission resumed its work and is actively preparing for the new reception 2015! ... Read more about Schedule in June . ... The Dean of Mechanics and Mathematics Faculty, the head of the Department of Mathematical and Computer Analysis Methods, professor Vladimir Chubarikov ; . ... Read more about The Open Day . ... 2016 Mechmath admission for internetional students ...
... Center For International Education . Lomonosov Moscow State University . ... This film was created for the 50th Anniversary of the Center for International Education of Lomonosov Moscow State University in 2004. ... We hope that you will enjoy the film, and if you still have not made up your mind where to learn Russian or where to get education in Russia, when having seen this film, you will make your choice in favor of the Center for International Education of Lomonosov Moscow State University! ...
... О КАФЕДРЕ ? ... GENERAL INFORMATION ABOUT THE CHAIR . ... Кафедра ЮНЕСКО по изучению глобальных проблем и возникающих социальных и этических вызовов для больших городов и их населения на факультете глобальных процессов Московского государственного университета имени М.В. Ломоносова . ... Cоздание кафедры ЮНЕСКО на факультете глобальных процессов МГУ открыло новые возможности для научных исследований в области возникающих глобальных социальных и этических проблемљ и для их преподавания. ...
Synthesis and Use of Humic Derivatives Covalently Bound to Silica Gel for Np(V) Sequestration I.V. Perminova , L.A. Karpiouk, N.S. Shcherbina*, S.A. Ponomarenko§, St.N. Kalmykov, and K. Hatfield Department of Chemistry, Lomonosov Moscow State University, Moscow 119992, Russia Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow 119991, Russia § Institute of Synthetic Polymer ... I.V. Perminova, et al. ...
[
Текст
]
Ссылки http://www.mgumus.chem.msu.ru/publication/2006/2006-perminova-synthesis.pdf -- 258.4 Кб -- 09.07.2007
[
Текст
]
Ссылки http://mgumus.chem.msu.ru/publication/2006/2006-perminova-synthesis.pdf -- 258.4 Кб -- 09.07.2007 Похожие документы
... Study (Michael & Houchin 1979) is an example of one of the first nonparametric approaches to EEG segmentation. ... As we noted, the main disadvantage of this approach to segmentation was the lack of adaptability of segment boundaries to the actual piecewise stationary structure. ... One may also expect that the change-points can reveal the consecutive operations of neuronal networks, with different time scales according to parameters of the algorithm of change-point detection (Kaplan et al. 1997b). ...
... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
ВМиК-Online! ... Студенты . ... Выпускники . Работа . ... Компания HP создает новые возможности для того, чтобы технологии приносили максимальную пользу людям, компаниям, государственным структурам и обществу в целом. ... Бизнес HP в России уже 6 лет подряд показывает результаты лучше рынка ИТ в целом. ... Вакансии компании Hewlett-Packard: . ... Телефон компании HP: +7 (495) 797-35-00. ... МГУ . ... Рейтинг компаний составляется на основе данных Клуба выпускников МГУ . ... 2001 2012 ВМиК Online! ...