О факультете . ... 15 марта 2016 года декан биологического факультета Михаил Петрович Кирпичников стал лауреатом премии имени А. А. Баева. ... 27 марта 2016 года, в рамках общеуниверситетского дня открытых дверей, прошел день открытых дверей на биологическом факультете. ... 11- 15 апреля 2016 года на Биологическом факультете пройдет конференция Ломоносов-2106, секция Биология. ... Срок обучения на биологическом факультете в бакалавриате 4 года, в магистратуре 2 года. ... Биологический факультет МГУ . ...

Еще в разделе: (Показать все результаты (>7) - www.bio.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

... Media Files . ... There are media files (ppt, pdf of presentations shared by authors) on this page. ... Alexander Gusev (SAI), Boris Artamonov (SAI) . ... Maidanak Observatory by AZT-22 1.5m telescope observations (poster) . PDF [2.3€аMB] . ... PDF [692.6€аKB] . ... PDF [704.7€аKB] . ... Some results after 10 years of site testing at Concordia . ... Giant Magellan telescope site testing summary (poster) . ... Peter Scheglov - pioneer of site testing in the Central Asia (poster) . ...

Еще в разделе: (Показать все результаты (>196) - site2010.sai.msu.ru/ )

• Timetable
• General information
• Results of recent and ongoing site programs

Here is a list of previous events held by our Department. April 23, 2012 . Round Table Repeated Speech: Between a Commonplace and an Artistic Experiment held as a part of the Lomonosov Readings conference. ... Lecture Language, Culture and Hegemony: Rethinking the Politics of Culture in the єбє¬ntext of the Russian Revolution . ... Round Table . ... November 30, 2011 . ... Round Table Reading a Monument: A Memorial Place in the City (held as a part of the conference Polyphony of the City ). ...

Еще в разделе: (Показать все результаты (>5) - discours.philol.msu.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>89) - npidb.belozersky.msu.ru/ )

... Research . Research Areas . ... Home News Colloquium on 18.05.09 . ... New publications of laboratory employees: . ... Colloquium on 26.02.09 . ... Colloquium on 24.12.12 20 Dec 2012 . ... Colloquium on 23.11.12 22 Nov 2012 . ... Colloquium on 19.10.12 15 Oct 2012 . Lomonosov Moscow State University . Department of Chemistry . ... Division of Physical Chemistry . Laboratory of Chemical Thermodynamics . ... 2000-2016 Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>40) - td.chem.msu.ru/ )

• Colloquium on 07.12.12 Laboratory of Chemical Thermodynamics
• Colloquium on 09.11.12 Laboratory of Chemical Thermodynamics
• Colloquium on 14.12.12 Laboratory of Chemical Thermodynamics

Apache2 Ubuntu Default Page . It works! This is the default welcome page used to test the correct operation of the Apache2 server after installation on Ubuntu systems. ... Ubuntu's Apache2 default configuration is different from the upstream default configuration, and split into several files optimized for interaction with Ubuntu tools. ... The configuration layout for an Apache2 web server installation on Ubuntu systems is as follows: /etc/apache2/ |-- apache2.conf | ... Document Roots . ...

208. Department of General Physics and magneto-ordered matter. Physics Department of

209. http://www.eng.math.msu.su/download/Abstract2014.pdf

210. AstroTop-100 - НАРОДНЫЙ РЕЙТИНГ

211. http://www.enzyme.chem.msu.ru/ryabov/pdf/AC_00.pdf

212. Symbolic circuit processor

213. http://www.antropos.msu.ru/vestnic/e2014_1.doc

214. Ф-502

215. http://www.chem.msu.ru/eng/misc/babaev/papers/032e.pdf

216. http://www.mgumus.chem.msu.ru/publication/2006/2006-perminova-synthesis.pdf

217. http://qsar.chem.msu.ru/~dmitry_o/gskdata.html

218. News. 14 European Symposium on Gas Phase Electron Diffraction

219. Новый сайт | Доклады по экологическому почвоведению

220. Inter-Congress Meetings