. Name . Last modified . Size . Description . Parent Directory . - . Hbond_1A1L.pdb1.xls . 2009-08-06 22:08 . 8.0K . result.txt . 2009-08-06 22:08 . 1.1K . Apache/2.4.10 (Debian) Server at monkey.belozersky.msu.ru Port 80

Еще в разделе: (Показать все результаты (>81) - monkey.belozersky.msu.ru/ )

• Index of /npidb/pdb/results/480cbee9-1c7b-43f8-9f4a-4608cfab4b12
• Index of /npidb/pdb/results/6e2add40-6dee-4b72-8147-8694fdbdb763
• Index of /npidb/pdb/results/761d8cc5-4592-4fe2-bc90-86ae73ddfdf3

. Name . Last modified . Size . Description . Parent Directory . - . Hbond_1A1L.pdb1.xls . 2009-08-06 22:08 . 8.0K . result.txt . 2009-08-06 22:08 . 1.1K . Apache/2.4.10 (Debian) Server at monkey.belozersky.msu.su Port 80

Еще в разделе: (Показать все результаты (>10) - monkey.belozersky.msu.su/ )

• Index of /npidb/pdb/results/480cbee9-1c7b-43f8-9f4a-4608cfab4b12
• Index of /npidb/pdb/results/6e2add40-6dee-4b72-8147-8694fdbdb763
• Index of /npidb/pdb/results/761d8cc5-4592-4fe2-bc90-86ae73ddfdf3

. Name . Last modified . Size . Description . Parent Directory . - . Hbond_1A1L.pdb1.xls . 2009-08-06 22:08 . 8.0K . result.txt . 2009-08-06 22:08 . 1.1K . Apache/2.4.10 (Debian) Server at mouse.belozersky.msu.ru Port 80

Еще в разделе: (Показать все результаты (>18) - mouse.belozersky.msu.ru/ )

• Index of /npidb/pdb/results/480cbee9-1c7b-43f8-9f4a-4608cfab4b12
• Index of /npidb/pdb/results/6e2add40-6dee-4b72-8147-8694fdbdb763
• Index of /npidb/pdb/results/761d8cc5-4592-4fe2-bc90-86ae73ddfdf3

. Name . Last modified . Size . Description . Parent Directory . - . Hbond_1A1L.pdb1.xls . 2009-08-06 22:08 . 8.0K . result.txt . 2009-08-06 22:08 . 1.1K . Apache/2.4.10 (Debian) Server at npidb.belozersky.msu.ru Port 80

Еще в разделе: (Показать все результаты (>12) - npidb.belozersky.msu.ru/ )

• Index of /data/results/480cbee9-1c7b-43f8-9f4a-4608cfab4b12
• Index of /data/results/6e2add40-6dee-4b72-8147-8694fdbdb763
• Index of /data/results/761d8cc5-4592-4fe2-bc90-86ae73ddfdf3

... Education: November 2001 ­ December 2004 Ph.D., Chemistry September 1996 ­ June 2001 B.S./M.S., Chemistry Research Experience: November 2001 - December 2004 Graduate student with Prof. Bulat Churagulov in the laboratory of Prof. Yury Tretyakov November 2002 ­ August 2003 Scientific training with Dr. C. Colbeau-Justin Prof. J.-P ... Yu.V. Kolen'ko, V.D. Maximov, A.A. Burukhin, V.A. Muhanov and B.R. Churagulov "Synthesis of ZrO2 and TiO2 nanocrystalline powders by hydrothermal process". ...

Еще в разделе: (Показать все результаты (>72) - www.inorg.chem.msu.ru/ )

• Inorganic Synthesis Laboratory
• Inorganic Synthesis Laboratory people
• Group of Hydrothermal Synthesis :: Awards

... International Scientific Conference "Probability Theory and its Applications" on Occasion of the 85-th Birthday of Yu.V.Prokhorov љis organized by the Steklov Mathematical Institute andљFaculty of Computational Mathematics and Cybernetics of Moscow State University fromљ12 to 14 of February, 2015 and will take place at the Faculty of Computational Mathematics and Cybernetics of Moscow State University .љ ...

Еще в разделе: (Показать все результаты (>2) - smu.cmc.msu.ru/ )

... About hotel . Services . ... The hotel ?69th Parallel? is glad to present its renewed website which now has an option of online booking! Feel free to share your opinion about us .. Hotel "69 Parallel" offers its guests meeting room for meetings, seminars and presentations. ... The cost of the lease without the use of equipment is 200 rubles for one hour. ... Order: (8152) 253-700, reserv@69parallel.ru . ... The hotel "69 Parallel" gives you the following list of services: . ...

Еще в разделе: (Показать все результаты (>4) - 69parallel.ru/ )

The M.V. Lomonosov Moscow State University is organizing a traditional International Conference "BIOCATALYSIS-2007" in 17-22 June 2007 (preliminary dates were changed). ... Structure, catalytic mechanism and protein engineering of enzymes. ... EURO . ... In view of a limited number of ship cabin passengers, the Organizing Committee is asking to apply for participation at BIOCATALYSIS-2007 Conference, to send the Abstracts and to pay the Registration Fee not later than the deadlines indicated above. ...

Еще в разделе: (Показать все результаты (>161) - www.enzyme.chem.msu.ru/ )

• Group of microbial biochemistry and biotechnology
• Web-site of graduates from Chemistry Faculty of Moscow State University in 1980
• Personal page of professor Vladimir Tishkov

. Photos from 2011 meeting .

Еще в разделе: (Показать все результаты (>4) - upmsu.phys.msu.ru/ )

• Photos from 2012 meeting
• Photos from 2015 meeting

... Q0EEG8_TAXDI Length: 274 # Q0EEG8_TAXDI Number of predicted TMHs: 6 # Q0EEG8_TAXDI Exp number of AAs in TMHs: 131.90669 # Q0EEG8_TAXDI Exp number , first 60 AAs: 22.31283 # Q0EEG8_TAXDI Total prob of N-in: 0.33607 # Q0EEG8_TAXDI POSSIBLE N-term signal sequence Q0EEG8_TAXDI TMHMM2.0 outside 1 30 Q0EEG8_TAXDI TMHMM2.0 TMhelix 31 53 Q0EEG8_TAXDI TMHMM2.0 inside 54 65 plot in postscript, script for making the plot in gnuplot, data for plot . ...

Еще в разделе: (Показать все результаты (>5186) - kodomo.fbb.msu.ru/ )

• Query Results
• tanchiki: vector.py diff
• allpy: 936463fb68b2

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... A member of the Russian Academy ofsciences, a great physicochemist,and a world-renowned Professor Boris Vladimirovich Derjaguin died on May scientist, he laid the foundation of the modern science of colloids and surfaces. ... B. V. Derjaguin became known world-wide in scientific circles for his work on the stability of colloids and thin films of liquids which is now known as the DLVO theory, after the initials of its authors: Derjaguin, Landau, Verwey, and Overbeek. ...

Еще в разделе: (Показать все результаты (>43) - nanofluidics.phys.msu.ru/ )

• Teaching
• Olga I. Vinogradova

Дистанционные курсы в Московском государственном университете имени М.В.Ломоносова . ... МГУ - школе . Факультеты . ... Дистанционные подготовительные курсы для абитуриентов . ... Запись на дистанционные подготовительные курсы биологического и философского факультета открыта. ... Оформленный договор на обучение по дистанционным программам МГУ следует отсылать на почтовый адрес ФАКУЛЬТЕТА, указанный на последней странице договора с указанием получателя: "Дистанционные подготовительные курсы". ...

Еще в разделе: (Показать все результаты (>3) - de.msu.ru/ )

... Institute of Mechanics . ... In 1977- 1991 A .P.Seyranian was a Member of Scientific Staff at the Institute of Problems in Mechanics of the Academy of Sciences in Moscow . ... Since 1993 A .P.Seyranian is a Leading Researcher and Professor of the Institute of Mechanics , Moscow State Lomonosov University . ... In 2003 he became an Invited Speaker and Chairman of the Session 'Stability and Control Problems in Mechanics' at the conference 'Physics and Control 2003' , Sankt-Petersburg. ...

Еще в разделе: (Показать все результаты (>3) - seyranian.imec.msu.ru/ )

• Professor Alexander P. Seyranian
• List of Publications of Prof. Alexander P. Seyranian

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Compression project . ... The goal is to design algorithm for automatic saliency maps construction for real-life video examples . ... Most of the existing methods are designed for still images . ... Content-aware compression . Content-aware quality estimation . ... We get probability of features extracted from binarized saliency maps using Relevance Vector Machine[3] . ... New methods development . ...

Еще в разделе: (Показать все результаты (>376) - graphics.cs.msu.ru/ )

• Grants and contracts | Graphics and Media Lab
• Point Cloud Classification | Graphics and Media Lab
• Road monitoring | Graphics and Media Lab

... Web portal on atmospheric environment is developed by international consortium as a be-lingual information resource in area of atmospheric physics and chemistry and in related domain air quality assessment and management. ... The portal has all typical component and services like collections of links, user group registration, discussion forum, etc. ... Each scientific site is an information-computational system designed in Internet technologies. ... 00189 138. ... 2003 . ... 2002, 252 . ...

Еще в разделе: (Показать все результаты (>6) - geophys.srcc.msu.ru/ )

... We thank the Swift team for their rapid scheduling of this observation. ... 2455705.20851 V 14.15 0.03 2455707.83079 V 14.10 0.03 2455710.84028 V 13.53 0.02 2455713.64631 V 13.66 0.02 2455714.65479 V 14.11 0.03 2455714.71823 V 14.12 0.02 2455714.78596 V 14.20 0.02 2455717.39593 V 14.37 0.03 2455726.62861 V 14.83 0.04 2455727.16343 V 14.57 0.04 2455730.50586 V 14.57 0.03 2455730.57329 V 14.56 0.03 2455730.70360 V 14.66 0.04 2455738.32865 V 14.00 0.02 2455742.86146 V 14.21 ...

Еще в разделе: (Показать все результаты (>2) - scan.sai.msu.ru/ )

• The NMW survey homepage

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>5) - sinp.msu.ru/ )

. Портал | Содержание | О нас | Авторам | Новости | Первая десятка | Дискуссионный клуб | Научный форум | Отправить открытку . Первая десятка "Русского переплета" Темы дня: . | Обращение к Дмитрию Олеговичу Рогозину по теме "космические угрозы": как сделать систему предупреждения? .

Еще в разделе: (Показать все результаты (>193) - www.pereplet.ru/ )

• News of Russian Science
• Интернет-журнал "Русский переплет"
• Super Ratio

The Day the World Changed Vocabulary Expressions I Task1. ... Nazi war criminals committed appalling atrocities during World War II. 2.debris ­ a quality of being well known for evil, esp. morally wicked actions. After the bombing there was a lot of debris everywhere. 3.resolve ­ an act of great evil, esp. cruelty, shocking, terrible. ... He didn't seem daunted by the difficulties facing him. 9.infamy ­ smth that needs attention, consideration, service, being more important than anything else. ...

Еще в разделе: (Показать все результаты (>20) - www.eng.math.msu.su/ )