... GhostView/GhostScript --- это программа для просмотра и печатания файлов в формате PostScript (PS). ... На диске содержатся: RusTeX ( TeX для DOS/Windows --- дистрибутив RusTeX и развернутый и работающий с диска RusTeX ); MikTeX ( TeX для Windows --- дистрибутив miktex и файлы для его руссификации); fpTeX ( TeX для Windows --- дистрибутив fpTeX, файлы для его руссификации и развернутый и работающий с диска руссифицированный fpTeX); WinEdt (оконный редактор с кнопочками для...

Еще в разделе: (Показать все результаты (>2) - tex.bog.msu.ru/ )

... совместно с А.А.Клячко ) . ... arXiv:1402.0887 . ... совместно с А.А.Клячко и с дополнением Д.В.Трушина ) . ... International Journal of Algebra and Computation, 2014, 24:4, 413-428 . ... МГУ, 2014, Диссертация . On the rank of the intersection of free subgroups in virtually free groups . ... совместно с А.А.Клячко , Н.Ю.Макаренко и Е.И.Хухро ) . ... Вестник МГУ, 2011, 5, 6-14 . ... Вестник МГУ, 2005, 3, 56-58 . ... Антон Владимирович Трофимов . ... Вестник МГУ, 2007, 1, 7-13 . ...

Еще в разделе: (Показать все результаты (>14) - halgebra.math.msu.su/ )

Conference on 'Reflections on the atomic nucleus', 28.06.2015, Liverpool, UK. This meeting, see http://ns.ph.liv.ac.uk/Reflections2015 , will touch upon a few sub-topics of current interest in nuclear structure physics including aspects of nuclear collectivity, strengths, shell evolution and super-heavy elements as well as sessions devoted to nuclear astrophysics, fundamental physics and new experimental probes. ... The conference fee is ?100. ...

Еще в разделе: (Показать все результаты (>3) - www.msu.dubna.ru/ )

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>6) - mph.cmc.msu.ru/ )

• MPH-CMC-MSU

... Not until everyone ... by the Customs Authorities were passengers allowed to enter the country. had searched . ... Were ... being robbed . ... Peter is not ... he seems. so self-confident like . ... The more you read in English, .... your command of the language will be better . will be better your command of the language . the better your command of the language will be . your better command of the language will be . ... The food is ... and it tastes .... quite expensive ... badly . ...

Еще в разделе: (Показать все результаты (>5) - anazarenko.ffl.msu.ru/ )

• Дистанционные курсы

ASA) (ASA) 20 c . ... 800 , ASA . ... Acoustic tomography with nonuniformly sparsed ring antenna array The main goal is to study: the quality of ultrasound fields generated by therapeutic multi-element arrays when the focus is steered electronically; nonlinear propagation effects in heating of soft tissue in the presence of ribs using therapeutic arrays. ...

Еще в разделе: (Показать все результаты (>37) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/gusev_files/nano2.pdf
• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/prsla02.pdf
• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/trubochki.pdf

: .. : -.doc : L:\RESULTS : C:\Documents and Settings\Victor\Application Data\Microsoft\\Normal.dot : : : Victor : : : 25.07.2006 1:16 : 2 : 25.07.2006 1:33 : Victor : 17 . : 30.07.2006 1:37 : 19 : 4 (.) : 28 (.)

Еще в разделе: (Показать все результаты (>2) - atm563.phys.msu.ru/ )

eґmail: ekakorkiya@mail.ru) , , - , , -, , , , , safety, spiritual development, spiritually-moral education, spirituality, the content-analysis, Postmodern society, occult sects, traditional religions, youth - , . ... It is necessary to consider theoretical achievements of religious thought of traditional religions of the people of Russia for the clearing the categories of spirituality and construction on this basis of concepts of spiritually-moral education of the young generation. ...

Еще в разделе: (Показать все результаты (>25) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2013/4/11.pdf
• http://www.socio.msu.ru/vestnik/archive/2010/3/06.pdf
• http://www.socio.msu.ru/vestnik/archive/2011/4/05.pdf

Главная Международные связи Иностранным студентам/ Incoming students . ... Semester Dates for International Students: . ... In case of institutional agreement on international student exchange the program is free of charge. ... All students should come to Russia by Moscow State University invitation. ... Students enter Russia with a single-entry visa. ... Exams/Passes . ... Pass . ...

Еще в разделе: (Показать все результаты (>30) - www.mgubs.ru/ )

• Высшая школа бизнеса МГУ им. Ломоносова

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• ConClus

... Геология >> Геотектоника | ... Добавить новое сообщение . ... Учебное пособие "Введение в тектонофизику". Гончаров М. А., Талицкий В. Г., Фролова Н. С. Ответ. ... Тезисы научной конференции ЛОМОНОСОВСКИЕ ЧТЕНИЯ, ноябрь 2011 года СЕКЦИЯ ГЕОЛОГИЯ: . ...

Еще в разделе: (Показать все результаты (>5) - phys.web.ru/ )

• Лекции Ярошевского А.А. "Проблемы современной геохимии" - Все о Геологии
• Бетехтин А.Г. "Курс минералогии", 1951 г. - Все о Геологии (geo.web.ru)

Mechmath admission for internetional students . Specialist degree . ... Specialist variants . Master degree . ... Master variants . ... The specialist programme is a first step to the science in a life of every man. On the morrow of the education, students get a specialist degree and a diploma of higher education in two languages . ... The list of enterance examinations for Mathematics and Mechanics Faculty?s entrants . ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>4) - pk.math.msu.ru/ )

• Master programme | Mechmath admission for internetional students
• Philosophy Doctor Programme | Mechmath admission for internetional students
• Information | Mechmath admission for internetional students

... Preliminary evaluation of forest ecosystems' state near the smelter was made, the monitoring methodology for polluted areas was developed, and critical loads of acid deposition were assessed (see also soil.msu.ru/projects/acidification/ ). ... The new built up database on forest ecosystem data for permanent monitoring plots was used for analysis of soil chemical state in forest ecosystems subjected to airborne pollution in the fragile boreal environment in the Norwegian-Russian border area. ...

Еще в разделе: (Показать все результаты (>25) - eco.soil.msu.ru/ )

• Acid Deposition and Forest Soils. Eds. V.Nikonov G.Koptsik
• MULTIVARIATE ANALYSIS OF SOIL CHEMICAL PROPERTIES
• ASSESSMENT OF SOIL SUSTAINABILITY TO ACID DEPOSITION

ISSN 1560-3547, Regular and Chaotic Dynamics, 2015, Vol. ... 6 2015 SEQUENTIAL DYNAMICS IN THE MOTIF OF EXCITATORY COUPLED ELEMENTS 703 Then the system under study equation): 1 = = 2 3 = takes the following form (we deleted two multipliers from every (F (2 )+ F (3 ))1 (-1+2F (3 ) - 1 2 ), (F (3 )+ F (1 ))2 (-1+2F (1 ) - 2 2 ), (F (1 )+ F (2 ))3 (-1+2F (2 ) - 3 2 ). ... Vol. ... 6 2015 SEQUENTIAL DYNAMICS IN THE MOTIF OF EXCITATORY COUPLED ELEMENTS 709 function, the system takes the form (4.2). ...

Еще в разделе: (Показать все результаты (>108) - ics.org.ru/ )

• Institute of Computer Sciences - Publications

... Web Extension to American Psychological Association Style (WEAPAS) (Rev. 1.4.3) [WWW document]. URL http://www.beadsland.com/weapas/ . Этот документ содержит дополнения к Приложению 3-A (Appendix 3-A, APA, 1994 , pp. 189-222) и использует стандарт Интернет касающийся унифицированных локаторов ресурсов (URL) ( Graham, 1995 ), используемый на World Wide Web (WWW или Web) ( W3C, 1995 ). ... Желающие использовать библиографический стиль MLA могут обратиться к Walker ( 1995 ) и Wainwright ( 1995 ). ...

Еще в разделе: (Показать все результаты (>4) - psyberlink.flogiston.ru/ )

... Il etait une fois nous deux . ... salut . Et si tu n'existais pas . ... Et si tu n'existais pas Dis-moi pourquoi j'existerais Pour traоner dans un monde sans toi Sans espoir et sans regret Et si tu n'existais pas J'essaierais d'inventer l'amour Comme un peintre qui voit sous ses doigts Naоtre les couleurs du jour Et qui n'en revient pas Et si tu n'existais pas Dis-moi pour qui j'existerais Des passantes endormies dans mes bras Que je n'aimerais jamais Et si tu n'existais ...

Еще в разделе: (Показать все результаты (>5) - optics.sinp.msu.ru/ )

... Next Routine] [List of Routines] NAME: ADD_HEADER PURPOSE: addition information from FITS-headers MPFS-frames DESCRIPTION: The function computes the total exposure, mean value zenit distance and modified FITS header CALLING SEQUENCE: Result =ADD_HEADER( headers ) CATEGORY: reduction MPFS-data INPUTS: Headers = String array FITS-headers from the MPFS data OUTPUTS: Header = String array containing the header from the FITS file. ... OPTIONAL INPUT KEYWORD PARAMETERS: BEFORE = Keyword string name. ...

Еще в разделе: (Показать все результаты (>45) - sn.sai.msu.ru/ )

• Olga Silchenko

... Инженерия академического текста . Что такое хороший аналитический текст  (учебное эссе, курсовая работа, диплом или диссертация, статья) ?  Ясно, что  не результат соблюдения проформы (введение   - основная часть   -   заключение), не монтаж из ?правильных? тезисов , подкрепленных  примерами ,  и не поток  фактов  вперемежку с  личными соображениями .  ... Учебное пособие для вузов?. М., 2015. ... Пятница, 19 февраля 2016 . 14.4 0 -16.10 . ... Comments (0) . ... Name (required) . ...

Еще в разделе: (Показать все результаты (>10) - discours.philol.msu.ru/ )

• Free verse and free dance

... Department . ... Alexander Pozdneev at the ASMS 2008 Conference . ... The 56th ASMS Conference on Mass Spectrometry took place in Denver (CO, USA), June 1-5, 2008. ... International conference "Mass Spectrometry and Allied Topics" is an annual meeting of the American Society for Mass Spectrometry (ASMS). Approximately 7000 scientists attended this conference, and over 3000 research papers have been presented in 2008. ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>13) - ani.cmc.msu.ru/ )

• The ASR Department at the CMC Faculty of Lomonosov MSU | Department of the

Core information (Nucleus, Levels, Gamma transition, Decays, Data type) . ... any adopted (levels and gammas only) experimental . ... Query parameters: . Select for output . ... Levels (E, JPI, T1/2, etc.) ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . Relative photon intensity . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ...

Еще в разделе: (Показать все результаты (>2) - depni.sinp.msu.ru/ )