Lomonosov Moscow State University was established in 1755 . ... Lomonosov Moscow State University Diary . ... MSU Web Sites . ... General Information . ... Study and Research . ... MSU Online . ... Research Priorities in Sciences at MSU: . ... MSU-RAS Research Institute of Soil Science . ... Research Priorities in Humanities at MSU: . ... Research Priorities in Social Sciences at MSU: . ... Research Priorities in the Humanities at MSU: . ... Research Priorities in Sciences and Humanities at MSU: . ...

Еще в разделе: (Показать все результаты (>78) - www.msu.ru/ )

• Victor Antonovich SADOVNICHY
• International Summer Schools at Lomonosov Moscow State University
• The scheme of an arrangement of MSU buildings on Leninskiye Gory

... 1978 May, Woods (Intel) 16 dRAM . 1979 Ziegler, Landford (IBM) , 106 e- 1 ґ SEU (Upset). ... 2005 RISC- (RAD750) IBM - Bae Systems 106 - 60 +125 0 200 Curiosity ( ). 200 000 greens. ... 2,54 (100 ) Al. ... 12. - (e-h) , 100 / N (t = 200 ) 2- . ... 50 100 N- 175 100 e-h . ... 200-800 ~ 1000 2***. ... INCL4Liege (. 33), ~ 60 /c , 180 /c. E*(t) , , . ... 270 Hs ( ~ 20 ) 4 GSI, . ... 45. (e-h ), SV1 1 - (800 ) p + 184W W- , . ... SEE-, ' Geant4. , , . ... 48. ґ 180 p + 27Al, () Geant4 ( ) Geant4 ( ). ...

Еще в разделе: (Показать все результаты (>89) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/21proceed/589.pdf
• http://danp.sinp.msu.ru/LIIWM/Nimb245_06_28Balashova.pdf
• http://danp.sinp.msu.ru/Articles_GSIB/nimb_smoothing_ZNOfilms_GCIB.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

CURRICULUM VITAE SERGEY BALAKHONOV Lomonosov Moscow State University (MSU) Department of Materials Science , Inorganic Chemistry Division Laboratory MSU, Leninskie Gory 1/3, GSP-1, Moscow , 119991, Russia Name Born Nationality Age Marital state Home address Phone number Fax number E-mail Web Sergey Balakhonov 26.09.1987 in Bryansk, Russia Russian Federation 23 years old Unmarried 119991, ... Hydrothermal / solvothermal and hydrothermal-microwave synthesis. ...

Еще в разделе: (Показать все результаты (>44) - www.inorg.chem.msu.ru/ )

• Group of Hydrothermal Synthesis :: News
• Index of /sis/ShevGroup/img

... A12, 1416, doi:10.1029/2001JA005090, 2002 Simultaneous acceleration and pitch angle scattering of field-aligned electrons observed by the LEPA on CRRES G. A. Abel,1 A. N. Fazakerley, and A. D. Johnstone2 Mullard Space Science Laboratory, University College London, Surrey, United Kingdom Received 1 October 2001; revised 20 March 2002; accepted 26 April 2002; published 3 December 2002. ... The electrons are then seen to scatter to 90° pitch angle with no further change in energy. ... Figure 6. ...

Еще в разделе: (Показать все результаты (>216) - www.kosmofizika.ru/ )

• Index of /lazutin
• Index of /ucheba
• Index of /buri/prepare/Metatech Advisories.files

... A new mechanism governing the dynamics of territory changing between groups of people such as countries is proposed based on trading with approval of both sides under particular voting rule (veto rule, majority rule, etc.) ... A state equation is obtained based on particular personal utility function. ... The countries which have approximately the same marginal 4 utility of the territory at the border would fight rather than trade as a result of equilibrium in the corresponding game. ...

Еще в разделе: (Показать все результаты (>11) - belyakov.imec.msu.ru/ )

• Anton O. Belyakov

A GENETIC ALGORHYTM FOR OPTIMIZING A NEURAL NETWORK CAPABLE TO LEARN FOR FOOD SEARCHING IN A RADIAL MAZE Budilova E.V., Chepurnova N.E., Chepurnov S.A, Teriokhin A.T. M.V.Lomonosov Moscow State University, Dept. of Biology. ... The upper platform has a hole in the middle and several radially directed tubular canals ("arms") each of which can contain a peace of food and has doors opening only in the centrifugal direction. ... The task of the animal is to visit only those arms which contain food. ...

Еще в разделе: (Показать все результаты (>36) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2000_Longev_JEvolBio.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/1999_Seasons_EER.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Birthweight_JEvolBio.pdf

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>5) - edas2.bioinf.fbb.msu.ru/ )

• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

Abstract British Foreign and Defence policy in the light of the Ukrainian crisis 2014 Introduction After a decade of interventionism alongside the US, a feeling of "war-weariness and warwariness" (as coined by ex-Chief of the General Staff General Lord Richard Dannatt) is prevalent in the British forces as well as the British society as a whole. ... As an example, one of the main targets was Mykola Azarov, former PM of Ukraine until Januray 2014 and Olena Lukash, a former Minister of Justice. ...

Еще в разделе: (Показать все результаты (>48) - www.spa.msu.ru/ )

• http://www.spa.msu.ru/uploads/files/nautchnaja_dejatelnost/manchester_diaspora.pdf

Summary Progress Report 2010 ґ 2014 UNESCO Chair on Global Problems and Emerging Social and Ethical Challenges for Large Cities and Their Population at the Faculty of Global Processes of the Lomonosov Moscow State University Period of activity: September 2010 June 2014 Title of the Chair : UNESCO Chair on Global Problems and Emerging Social and Ethical ... Visit of UNESCO Director-General Irina Bokova at Moscow State University September 9, 2011. ...

Еще в разделе: (Показать все результаты (>70) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2013/12/Luce_Moscow_2013_small.pdf
• http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-2.pdf
• sky пєп?п? п?п?пе п?п?. п?.п?. п?пЎп?пЎпҐпЎя?пЎп?п°

. This presentation contains content that your browser may not be able to show properly. This presentation was optimized for more recent versions of Microsoft Internet Explorer. If you would like to proceed anyway, click here .

Еще в разделе: (Показать все результаты (>23) - analyt.chem.msu.ru/ )

... Наука . ... 7(495) 939-4126 . ... Факс: 7(495)939-2988 . ... 2001 Klesch V.I. 2002 Ismagilov R.R. 1998 Lyashenko D.A. 1998 Zolotukhin A.A. 1998 Zakhidov A.A. 1998 Ustinov A.O. 2001 Kopylov P.G. 2001 Tyurnina A.V. 2001 Popov I.A. 2001 Mozharova A.E. 2001 Kuznetsov D.S. 2002 Ekutich L.A. 2003 Sorokin G.P. 2003 Lyashenko S.A. 2003 Apolonskaya I.A. 2004 Dolganov M.A. 2004 Shvets P.V. 2005 Khestanova E.A . ...

Еще в разделе: (Показать все результаты (>2) - carbon.phys.msu.ru/ )

... Andrey Lagarkov, Igor Budashov, Vladimir Chistyaev, Alexander Ezhov, Andrey Fedyanin, Andrey Ivanov, Ilya Kurochkin, Sergey Kosolobov, Alexander Latyshev, Dmitriy Nasimov, Ilya Ryzhikov, Maxim Shcherbakov, Aleksandr Vaskin, Andrey K. Sarychev . ... OPTICS EXPRESS . ... Ultrafast dynamics of third harmonic generation in fishnet metamaterials" . ... Nonlinear absorption in plasmonic metamaterials" . ... Static and dynamic properties of third harmonic generation in fishnet metamaterials" . ...

Еще в разделе: (Показать все результаты (>48) - nanolab.phys.msu.ru/ )

... Catalog . ... This web application is brought to you by the following people (in alphabetical order): . Alexey Sergeev, markup issues . Artemy Tregoubenko , JavaScript code . Elena Glushkova, content management . ... We would like to acknowledge the usage of these open source technologies: . Django , web framework . PostgreSQL , database management system . ... SAMP-Webtools , set of JavaScript tools for SAMP-enabled web applications . Developed by the Team . ...

Еще в разделе: (Показать все результаты (>3) - ocl.sai.msu.ru/ )

. This presentation contains content that your browser may not be able to show properly. This presentation was optimized for more recent versions of Microsoft Internet Explorer. If you would like to proceed anyway, click here .

216. Courses | Department of the Automation for Scientific Research CMC MSU

217. http://xray.sai.msu.ru/~polar/sci_rev/bethe.pdf

218. On Square Parachute Differential Equations

219. Solution Centre Engineer (Graduate) / Вакансии / Physcareer.ru

220. http://dynamo.geol.msu.ru/personal/vsz/posters/nlob/nlob2.html