... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Welcome to K -corrections calculator, simple service allowing one to determine K -corrections of a galaxy, given its redshift and one or more colours. ... K -correction in choose filter.. ... Redshift . Colour choose colour.. Colour value . Calculator . ... calculate spectral energy distributions , K-corrections calculator , GALEX FUV NUV , UKIDSS YJHK , K-corrections of galaxies , spectral based k-corrections , SDSS filter set K-corrections , K correction code IDL , kcorrect IDL C , . ...
Software on Data Processing . We Offer Statistical Software And . Software On Data Analysis And Processing. ... The package is intended for those, who doesn't have large experience in statistical analysis, but needs a quick and convenient data processing tool. ... Package provides full complex of registration and analysis methods, individual EKG monitor-analyzer, special tools for complete polygraph analysis. price: 700$ - 2200$. phone number (095) 437-3695, 155-1365 . ... InCo . ...
... Monitoring of relativistic electron fluxes in the near-Earth space. Development of the methods for studying of relativistic electrons of fluxes in the regions of precipitation. Studies of the fluxes and spectra of high-energy electrons of the outer radiation belt of the Earth. ... Studies of the fluxes and spectra of high-energy electrons in the low-latitudinal regions (at small L). ... Studies of VLF electromagnetic radiation generated during the main phase of the lightning discharge. ...
Application of the V--Ray Technology for Optimization of the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D Supercomputers Alexander S. Antonov, Vladimir V. Voevodin Moscow State University, Russia email: voevodin@vvv.srcc.msu.su Abstract The paper shows an application of the socalled V Ray Technology for optimizing the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D supercomputers. ... Results for CRAY YMP supercomputers. al structure of the program. ...
... Main fields of study for the qualification and specialization . ... Bachelor Integrated Programme . ... Name of qualification (degree): BACHELOR . Field of study: 04.03.02 Materials Chemistry, Physics and Mechanics . Official length of full-time programme: 4 years . ... Name of qualification (degree): MASTER . ... Name of qualification (degree): . RESEARCHER, ACADEMIC RESEARCHER . Field of study: 02.00.01 Inorganic chemistry . ... Field of study: 02.00.21 Solid state chemistry . ...
... education . research . ... Microstructure deeply influences the properties and thus the functionality of a material. In an X-ray diffraction pattern, the microstructure information is usually extracted from the breadth and shape of line profiles. ... Доклад ?Structure/microstructure and their interplay in nanomaterials and layered systems? оказался очень полезным и интересным для ученых, работающих в области неорганического синтеза и физико-химических методов исследования. ...
... справочник учебные материалы ссылки программы . ... TEST 1 (Text 1, Present Tenses) . I Write synonyms of the following. 1. main . ... 3. принадлежащий химии . ... фотоs учебные материалы : выберите дисциплину неорганическая химия аналитическая химия органическая химия химические основы биологических процессов физическая химия квантовая механика, химия и строение молекул радиохимия кристаллохимия коллоидная химия химия ВМС химическая технология история и методология ...
... Alexeyev V.L., Levich A.P. A search for maximum species abundances in ecological communities under conditional diversity optimization // Bull. of Mathemat. ... 1997. ... Bendoricchio G., JЬrgensen S.E. Exergy as a goal function of ecosystems dynamic // Ecological modelling. ... 1999. ... Comolli C.J., Donohue C., Timothy J. Pseudomonas aeruginosa RoxR, a response regulator related to Rhodobacter sphaeroides PrrA, activates expression of the cyanide- insensitive terminal oxidase. ... 1995. ... 2000. ...
[
Текст
]
Ссылки http://dis.bio.msu.ru/States/Fursova_Mil'ko_levich/Spisok.pdf -- 167.3 Кб -- 03.12.2009 Похожие документы
... About CIE MSU . ... Student's Life . ... Vestnik CIE (in Russian) . ... About Moscow University . ... Life . ... Students life in personal extracts presented to us by one of our students. A Normal Day, 30 Nov 2004, 11.20pm (Moscow time) . ... Since school always begins at 10am, my alarm-clock starts its attempts to wake me at 08.40am. ... But to get in time to the university I cannot sleep more then these ten extra minutes. ... As usual, I try to make all morning routines as regular as possible. ...
... Поведенческие реакции рыб на болевые стимулы . ... У костистых рыб (не имеющих коры головного мозга ) условнорефлекторное избегание аверсивного стимула вырабатывается легко, если этим рыбам свойственно в природе быстрое стремительное плавание. ... Cloning, Molecular Characterization, and Distribution of a Gene Homologous to delta-Opioid Receptor from Zebrafish (Danio rerio), Biochemical and Biophysical Research Communications, 1998, vol. 245, no. 2, pp. ... Proceed., 1969, vol. 28, no. 4, pp. ...
... Anti thrombin DNA aptamers were immobilized on silica microspheres, placed inside microwells on the distal tip on an imaging optical fiber, coupled to a modified epifluorescence microscope through its proximal tip. ... It should be mentioned that since thrombin is not a DNA binding protein, the possibility to elicit thrombinaptamer complexes clearly demonstrates the power of SELEX technology. ... Specificity of aptamer coated beads for F thrombin binding was assessed with bovine serum albumin. ...
[
Текст
]
Ссылки http://rnp-group.genebee.msu.ru/pages/pdf/biochem2002_1.pdf -- 101.2 Кб -- 18.02.2008 Похожие документы
Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete
[
Текст
]
Ссылки http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cs.msu.su/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cmc.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011 Похожие документы
Quantum Chemistry in Studies of Elementary Stages of Enzymatic Catalysis Alexander Nemukhin Department of Chemistry M.V. Lomonosov Moscow State University Russian Federation N.M. Emanuel Institute of Biochemical Physics Russian Academy of Sciences The aim is to study mechanisms of chemical reactions in complex molecular environment by considering J. Phys. Chem. ... Chem., ... Modeling, 2005, 11, 503 Grigorenko B., Rogov A., Nemukhin A. // J. Phys. Chem. ...
... It carries out the basic communication op erations, such as b oundary exchanges and transp ositions of decomp osed data. ... Data distribution b efore transp osition. б б бвб бв б б б бвбв б бв б бвбв б б б б б бвбв б бв б бвбв б б бвб бв б б б бвбв б б бвбв б б б б б бвбв б бв б бвбв б б бвб бв б б б бвб бв б б б бвб бв б б б бвб бв б б б б бвбв б бв бвбв б бв бвбв б бв бвбв б бв бвбв б бв б бвбв б б бвб бв б б б бвб бв б б б бвб бв б б б ...
Open Conference Systems . Conference Help . ... Conference Content Search . All Authors Title Abstract Index terms Full Text . ... Home . ... Home > 2014 International Conference on Laser Applications in Life Sciences > About the Conference > About this Conference System . This site uses Open Conference Systems 2.3.6.0, which is open source conference management software developed, supported, and freely distributed by the Public Knowledge Project under the GNU General Public License. ...
THE 75th NAME-LIST OF VARIABLE STARS. ... The 75th Name-List consists of two tables. ... the literature, taken from positional catalogues, including USNO A1.0/A2.0 and GSC, or determined by the authors); the range of variability (sometimes the column Min gives, in parentheses, the amplitude of light variation; the symbol ( means that the star , in minimum light, becomes fainter, than the magnitude indicated); and the system of magnitudes used ( P are photographic ...
... General Information . ... For physics faculty . ... Until 1939 in Moscow State University there was one undivided General Physics Chair. ... He was a leading scientist in the field of magnetic phenomena, and during 14 years the experimental and theoretical research of condensed matter magnetization, magnetic hysteresis and ferromagnetic resonance have been conducted under his leadership. ... In 2003 the Chair was renamed to Chair of General Physics and Magneto-Ordered Matter. ...
1 Faculty of Physics, Moscow State University, Moscow 119899, Russia; 2 Soil Science Faculty, Moscow State University, Moscow 119899, Russia . ... To estimate soil response to acid deposition we compared the soil field data along a pollution gradient and simulated time effects. ... Time response of soils to acid deposition was evaluated with the SMART model. According to field observations there is no evidence for strong soil acidification effects close to the smelter. ...