... Nonlinear optics of ionized mediums . Fiber lasers . ... Emergence of powerful laser systems, being able to deliver powerful ultrashort light pulses, allows one to investigate and exploit new class of nonlinear-optical phenomena, based on the media ionization, when the electrons are released by strong electromagnetic field directly or by collision of an atom with another electron accelerated in the field. ... Ultrafast optical switching of an ionized medium by interfering ultrashort laser pulses. ...
... Data . ... Planetary perturbations during geomagnetic storms are measured by the Dst index, which is the deviation of variation of the magnetic field from the undisturbed level, averaged over the values measured at the control chain of magnetic stations located in the low latitudes. ... To predict the hourly values of the Dst index, artificial neural networks (ANN) of perceptron type are used. ... Loading of the data on the values of the Dst index and forecast update are performed twice per hour. ...
... Monitoring of relativistic electron fluxes in the near-Earth space. Development of the methods for studying of relativistic electrons of fluxes in the regions of precipitation. Studies of the fluxes and spectra of high-energy electrons of the outer radiation belt of the Earth. ... Studies of the fluxes and spectra of high-energy electrons in the low-latitudinal regions (at small L). ... Studies of VLF electromagnetic radiation generated during the main phase of the lightning discharge. ...
... Work of a system constructing the exercises with the help of a teacher is described. Algorithms of fragmentation of sound data into phonemes and of analysis of correctness of pronunciation of a student are suggested. ... The authors offer the functioning variant of a system, making it possible to a student to appreciate objectively a degree of correctness of his pronunciation, to classify errors and to listen to a difference of pronunciations of incorrect sounds interactively. ...
1986. ... 1989?. ... 1988. ... 1992. ... Extraterrestrial cause for the Cretaceous-Tertiary extinction // Science. ... Vol.208, N 4448. ... Cretaceous-Tertiary event: Noble gases in Turkmenia K/T boundary sediments // Lunar. ... Elder W.P. Molluscan extinction patterns across the Cenomanian-Turonian stage boundary in the Western Interior of the United States// Paleobiology.1989.Vol.15. ... The Frasnian-Famennian extinction: current results and possible causes // Devonian of the . ... 1988.Vol. ...
... 53, Moscow, 117924 Russia *e-mail: grishan@comsim1.phys.msu.su **e-mail: zadkov@comsim1.phys.msu.su Received August 30, 2002 Abstract-- universal theory for calculating coherent population trapping resonances in multilevel atoms is suggested. ... Numerical simulation of coherent population trapping resonances shows that the open character of the system decreases the contrast of resonance curves in absorption spectra without changing resonance widths. ...
[
Текст
]
Ссылки http://qilab.phys.msu.ru/papers/jetp-96(4)-2003-preprint-en.pdf -- 986.4 Кб -- 04.02.2008 Похожие документы
Security of Quantum Key Distribution Protocol Based on Ququarts Alexander P. SHURUPOV 1 , and Sergei P. KULIK Faculty of Physics, Moscow M.V.Lomonosov State University Abstract. ... In case of D = 4 it was found, that in practice one can relatively easily prepare 12 states based on the polarization states of two-photon field and belonging to three mutually unbiased basis [5,6]. ... This setup allows one to split two orthogonal polarization states of biphoton, namely |H1 and |V2 ones. ...
[
Текст
]
Ссылки http://qi.phys.msu.su/papers/2007-nato-11-123.pdf -- 486.5 Кб -- 13.03.2007
[
Текст
]
Ссылки http://qi.phys.msu.ru/papers/2007-nato-11-123.pdf -- 486.5 Кб -- 13.03.2007 Похожие документы
Cell. ... In cells overexpressing MycN, as well as cells in which MycN was switched off, a-TOS stimulated rapid entry of Ca2? into the cytosol, compromised Ca2? buffering capacity of the mitochondria and sensitized them towards mitochondrial permeability transition and subsequent apoptotic cell death. ... 4 Mitochondrial Ca2? accumulation in NB cells with different level of MycN expression. a Accumulation of Ca2? by mitochondria in digitonin-permeabilized MycN(?) cells. ...
... Laboratory of Problems for Magnetism, . ... Study of the magnetic and transport properties of R-3d intermetallic compounds with a magnetic instability of the itinerant-electron subsystem. ... const at high temperatures (Curie-Weiss law) [A.S. Markosyan, Y. Hosokoshi, K. Inoue, Phys. Lett. ... Gaidukova, Y. Hosokoshi, K. Inoue, A.S. Markosyan , Magnetic phase diagram and pressure effect on the magnetic properties of the Y 1? x Gd x Mn 2 intermetallic compounds, J. Phys.: Condens. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Ролан Барт . ... Первый Всемирный конгресс моющих средств (Париж, 1954) возымел эффект, который заставил весь мир поддаться эйфории от ' Омо ': детергенты не только не раздражают кожу, но возможно они даже способны избавить шахтеров от силикоза. ... Полезно было бы сравнить психоанализ отбеливателей (хлорированных, например) с психоанализом мыльных порошков ('Люкс', ' Персил ') или детергентов (' Омо '). ... Барт Р. (1998). Мыльные порошки и детергенты (из книги "Мифологии") . ...
... Gas evolution from Brazilian rock crystal and quartz as raw materials for producing silica glass . ... Gas content, along with the content of element impurities and the content of mineral inclusions, is one of the most important characteristics of quality for quartz raw materials in producing high-quality silica glass. Gas evolution from rock crystal and vein quartz from Brazil as quartz raw materials for producing high-quality silica glass has been studied. ...
... The technique had been developed for calculating destruction of melting vitreous bodies in hypersonic gas flows taking into account the internal radiative transfer. ... The problem of flow in the chemically non-equilibrium boundary layer at a stagnation point of blunt body had been solved by the asymptotic method and formulas for the heat and diffusion fluxes to a surface of any catalycity had been obtained. ...
... Printed in U.S.A. NATURE OF NUCLEAR RINGS IN UNBARRED GALAXIES : NGC 7742 AND NGC 7217 O. K. Sil'chenko and A. V. Moiseev Special Astrophysical Observatory, Nizhnij Arkhyz 369167, Russia; moisav@sao.ru Received 2005 ... Isaac Newton Institute of Chile, Moscow Branch, Moscow 119992, Russia; olga@sai.msu.su ABSTRACT We have studied an unbarred Sb galaxy with a nuclear star-forming ring, NGC ... 1 7217, Pos. ... Left: Stellar velocity dispersion map for NGC 7217 according to the SAURON...
... Group of laser spectroscopy of solutions of supramolecular compounds and nanostructures . Tatiana A. Dolenko . ... Modern methods and possibilities of laser Raman spectroscopy. ... Vibrational spectroscopy of water solutions of amphiphilic compounds. ... Group of laser spectroscopy of solutions of supramolecular compounds and nanostructures is very young. ... Comparison of Input Data Compression Methods in Neural Network Solution of Inverse Problem in Laser Raman Spectroscopy of Natural Waters. ...
Inhibition of Horse Liver Alcohol Dehydrogenase by Methyltin Compounds Pavel V. Bychkov, Tatyana N. Shekhovtsova*, Elena R. Milaeva M.V. Lomonosov Moscow State University, Chemistry Department, Leninskie Gory, 119992 Moscow, Russia. ... The experimental results of the study show that inorganic tin and methyltin substances induce slight inhibition of the catalytic activity of horse liver alcohol dehydrogenase (HLADH), unable to be improved during pre-incubation with the enzyme. ...
[
Текст
]
Ссылки http://analyt.chem.msu.ru/kinetics/papers/Inhibition%20of%20Horse%20Liver%20Alcohol%20Dehydrogenase%20Bychkov%20191-%202005.pdf -- 932.8 Кб -- 25.09.2008 Похожие документы
... The philosophical consequences of synergetics, the interdisciplinary theory of evolution and self-organization of complex systems, are being drawn in the paper. ... Key words: complex systems, evolution, nonlinearity, pre-determination, self-organization, soft management, structure-attractors, synergetics 1. ... The spectra of possible, `allowed' structures correspond to sets of the eigenfunctions of the nonlinear equations describing the evolutionary processes in the complex system. ...
[
Текст
]
Ссылки http://www.students.chemport.ru/materials/Philosophy/orph.pdf -- 61.0 Кб -- 15.01.2009 Похожие документы
In the three and a half years of itтАЩs existence, the participants of the Ecological Cooperation Project have carried out more than 200 activities towards conserving and protecting the environment. ... Activities: . ... During the "We'll Conserve the EarthтАЩs Beauty" project at the Silicate lakes, near Lipetsk, the waste around a lake and in a forested area nearby was cleaned up. ... The members of ecological club from Gymnasium #1529, in Moscow, had a summer expedition to Solovetsky museum in 1999. ...
... May, 2005 . ... Moscow State University Russian Language Centre . Moscow State University . ... Learn Russian at the Moscow State University! Moscow Easter Festival comes to MGU . Classical music concerts in the Moscow State University happen often enough and always they are a holiday for professors and students. (more.. ... Group summer program "Moscow holidays" is the most popular group program at our Centre! ... Russian proverbs and sayings about Russian language: . ...