Information Security Meeting Schedule Thursday, March 30 12:00 noon Opening and Catered Lunch 1:00 R. Sekar, Stony Brook University - Ongoing Research at Secure Systems Laboratory at Stony Brook University 1:30 Scott Craver, Binghamton University - Information Hiding and Counterdeception 2:00 Sanjay Goel, University at ...

Еще в разделе: (Показать все результаты (>22) - suny.msu.ru/ )

• http://suny.msu.ru/ru/UpstateMemorandumEn.doc
• Center on Russia and the United States :: Currently available grants
• Center on Russia and the United States :: Summary of SUNY/MSU Center Activities

... Society . ... Viktor Titovich Trofimov , professor, Department Chairman at the Faculty of Geology, Vice President of the Lomonosov Moscow State University . ... Ksenia Vsevolodovna Avilova , Candidate of Biological Sciences, senior research associate of the Faculty of Biology at the MSU . Aleksandr Sergeevich Alekseev , Doctor of Geological Mineralogical Sciences, professor at the Faculty of Geology at the MSU . ... 2015 Moscow Society of Naturalists . ...

Еще в разделе: (Показать все результаты (>4) - www.moip.msu.ru/ )

Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...

Еще в разделе: (Показать все результаты (>8) - lvk.cs.msu.su/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... This plugin attempts to reduce the instance of Wiki Spam by using the MoinMoin AntiSpamGlobalSolution regex's. Anytime it detects that a saved page contains a string in the regex list, it only refuses to save it. ... Foswiki:Extensions/BlackListPlugin does alot of processing on every topic operation, including view) . ... Refresh the list using the rest script from a scheduled cron job cd [foswiki-bin-directory] ./rest /AntiWikiSpamPlugin/forceUpdate . ... This topic: System > AntiWikiSpamPlugin . ...

Еще в разделе: (Показать все результаты (>4531) - wiki.cmc.msu.ru/ )

• (r1) AntiWikiSpamPlugin < System < Foswiki
• BulkRegistration < System < Foswiki
• (r2) AntiWikiSpamPlugin < System < Foswiki

... This plugin attempts to reduce the instance of Wiki Spam by using the MoinMoin AntiSpamGlobalSolution regex's. Anytime it detects that a saved page contains a string in the regex list, it only refuses to save it. ... Foswiki:Extensions/BlackListPlugin does alot of processing on every topic operation, including view) . ... Refresh the list using the rest script from a scheduled cron job cd [foswiki-bin-directory] ./rest /AntiWikiSpamPlugin/forceUpdate . ... This topic: System > AntiWikiSpamPlugin . ...

Еще в разделе: (Показать все результаты (>1820) - wiki.cs.msu.ru/ )

• (r1) AntiWikiSpamPlugin < System < Foswiki
• (r2) AntiWikiSpamPlugin < System < Foswiki
• (r3) AntiWikiSpamPlugin < System < Foswiki

Irena Lasiecka ( University of Virginia ) . Nikolai Melnikov (CEMI / MSU) . Mikhail Zelikin (MSU / Steklov Institute) . G. Avalos ( University of Nebraska , USA ) . V. Borisov (MSU, Moscow) . ... O. Emanouvilov ( Colorado State University , USA ) . A. Fursikov (MSU, Moscow) S. Hansen ( Iowa State University , USA ) R. Hildebrand ( Joseph Fourier University , France) V. Komornik ( University of Strassburg, France ) A. Kowalewski ( Institute of Automatics, Poland ) . ... Moscow) . ...

Еще в разделе: (Показать все результаты (>3) - oc.cs.msu.su/ )

Call for Papers September 26-30, 2016 National Cultural Center "Minsk", Minsk, Belar us ICONO/LAT 2016 Int' l Conference on Coherent and Nonlinear Optics (ICONO 2016) Int' l Conference on Laser s, Applications, and Technologies (LAT 2016) The leading event in the area of quantum electronics, laser physics, photonics and their applications. ... Russia Vladimir Belyi, Stepanov Inst. of Physics, NASB, Belar us ICONO Program Vice-Chairs Yulia Vladimirova, Lomonosov Moscow State Univ., ...

193. http://www.botsad.msu.ru/docs/eng_iris2.doc

194. Microsoft Exchange - Outlook Web Access