... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...

Еще в разделе: (Показать все результаты (>2) - www.ccl.msu.su/ )

... Electronic journal Issue 4. 10 september 2004 Leigh E. Making Learning a Game Introduction. As a university lecturer I enjoy playing games with learning goals in mind. My students are all adults who work in many different roles. ... Their needs include learning how to design activities that will support acquisition of practical skills, extend personal understanding of emotional factors, and improve awareness of factors ­ such as economic, ecological and political aspects of society. ... Play. ...

Еще в разделе: (Показать все результаты (>7) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./vorontchuk.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./ulrich.pdf

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>5) - sinp.msu.ru/ )

... Статистика блога . ... результаты выборов психодиагностика работа с данными скачать SPSS мотивация профессии фото заработок в интернете экспериментальная психология измерение в психологии статьи полезные советы математические методы SPSS Evaluation Version IRT психологические журналы видео ссылки психометрика тестирование компетенции анализ и визуализация данных юзабилити опросы структурное моделирование тесты IBM SPSS Statistics диссертации dropbox графика в R геолокация регрессионный ...

Еще в разделе: (Показать все результаты (>17) - tukachev.flogiston.ru/ )

• Likert-Type Scale Response Anchors
• Category: Новости
• Tag: R

... include stdio.h # include stdlib.h int main( int argc, const char* argv[]) { FILE* f; int c, wordCnt = 0, inWord = 0; if (argc 2) { printf ( Use: %s filename\n , argv[0]); return 1; } f = fopen(argv[1], r ); if (f == NULL) { printf ( Can't open file: %s\n , argv [1]); return 1; } while ((c = fgetc(f)) if (!isspace(c)) if (! inWord ) { ++wordCnt; inWord = 1; } } ... int main() { enum {RUNNING, STOPPED} state; state = RUNNING; state = STOPPED; } RUNNING STOPPED · : 1. ...

Еще в разделе: (Показать все результаты (>4) - savenkov.lvk.cs.msu.su/ )

• http://savenkov.lvk.cs.msu.su/mc/lect04.pdf

IEEE Transactions on Computational Intelligence and AI in Games (Special Issue on Brain/Neuronal-Computer Games Interfaces and Interaction), 2013, in press. ... Adapting the P300-based brain-computer interface for gaming: a review Alexander Y. Kaplan, Sergei L. Shishkin, Ilya P. Ganin, Ivan A. Basyul, and Alexander Y. Zhigalov Abstract--The P300-based brain-computer interface (P300 BCI) is currently a very popular topic in assistive technology development. ... Neurophysiol ., vol. 113, pp. ...

Еще в разделе: (Показать все результаты (>65) - brain.bio.msu.ru/ )

• Laboratory for Neurophysiology and Neuro-Computer Interfaces (NNCI) (former
• Sergei Shishkin

Detoxifying Ability of Coal Humic Acids and Their Hydroquinone Enriched Derivatives in relation to Copper under Field Conditions Natalia Kulikova1, Vladimir Kholodov2, Galina Lebedeva1, Olga Philippova1, Anton Kovalenko3, Irina Perminova 1 3 Department of Soil Science, M.V. Lomonosov Moscow State University, Leninskie Gory, 119992 Dokuchaev ... 761 Detoxifying activity of the humic preparations was estimated by two-years field experiments conducted under sod-podzolic soil conditions. ...

Еще в разделе: (Показать все результаты (>121) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2006/2006-perminova-synthesis.pdf
• http://www.mgumus.chem.msu.ru/arw/book-content.doc
• http://www.mgumus.chem.msu.ru/publication/2007/perminova-preparation-2007.pdf

... Multi-threaded search engines . ... Unfortunately, most documents on search engines I saw in the Internet were either lists of hyperlinks without any comments, or discussions about how many documents are in the database of ... (here is the name of a search engine) and what method of counting of the number of documents was used. No words about the efficiency, i.e. how many documents on some subject I can find using this search engine, especially in comparison with the other ones. ...

Еще в разделе: (Показать все результаты (>3) - scon155.phys.msu.ru/ )

... Инструкция по работе с информационными ресурсами в ОРОКС . ... Основные разделы сервера: Выбор раздела сервера ------------------------------------ На первую страницу "ChemNet" ------------------------------------ Химический факультет МГУ ------------------------------------ Электронная библиотека по химии ------------------------------------ Базы данных и другие источники информации по химии ------------------------------------ Периодические издания по химии -- Вестник МГУ. ...

Еще в разделе: (Показать все результаты (>2) - do.chem.msu.ru/ )

... 6:30 - 7:00pm |Transit to Executive Learning | ... 8:00 - 10:00pm |Dinner |Executive Dining Room | ... 10:30 - 10:45am |Funds |Executive Dining Room | Claude Legrand |10:45am - 12:30pm|Refreshment Break |ELC x.206 | ... 10:30 - 10:45am |Refreshment Break |Executive Dining Room | ... Lunch |Executive Dining Room | ... 2:30 - 2:45pm |Refreshment Break |Executive Dining Room | ... 4:00 - 4:15pm |Refreshment Break |Executive Dining Room | ... 5:15 - 5:30pm |Refreshment Break |Executive Dining Room | ...

Еще в разделе: (Показать все результаты (>2) - www.innovation.msu.ru/ )

• http://www.innovation.msu.ru/SEEC-LMSU_Detailed_Program_Itinerary_Nov4-Nov12_2007.doc

Using Site testing data for Adaptive Optics simulations Kislovodsk, October 2010 1Glen Herriot, 1David Andersen, 1Jean-Pierre VИran, 2Brent Ellerbroek, 2Luc Gilles, 2Lianqi Wang 1National Research Council Canada ­ Herzberg Institute of Astrophysics 2TMT Project Office, Pasadena TMT.AOS.PRE.10.074.REL01 1 Outline TMT / NFIRAOS Site Testing Parameters and their value for Adaptive Optics Simulations ... TMT.AOS.PRE.10.074.REL01 9 What is the interest of Adaptive Optics in r 0 Seeing ? ...

Еще в разделе: (Показать все результаты (>195) - site2010.sai.msu.ru/ )

• General information
• Information

Langmuir 2005, 21, 8243-8249 8243 The "Wimple": Rippled Deformation of a Fluid Drop Caused by Hydrodynamic and Surface Forces during Thin Film Drainage Lucy Y. Clasohm,, Jason N. Connor,,| ... In Final Form: June 16, 2005 It is well-known that hydrodynamic pressures in a thin draining liquid film can cause inversion of the curvature of a drop or bubble surface as it approaches another surface, creating a so-called "dimple". ... WimplesRippled Deformation of a Fluid Drop Langmuir, Vol. ...

Еще в разделе: (Показать все результаты (>41) - nanofluidics.phys.msu.ru/ )

• Laboratory of Micro- and Nanofluidics
• Teaching

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

... Scaliger sometimes forgot as anyone will when doing chronological computations whether he sought a current or a completed year, and therefore gave Julian dates that did not actually match the cyclical dates his computations had determined (e.g. eras 37,42, and 49). ... This table lists all the eras explicitly given as such by Scaliger, with their positions in the Julian Period and their dates in years BC or AD. ... To find a year in this era, subtract 296 from the date in the era of the Hegira. ...

Еще в разделе: (Показать все результаты (>86) - hbar.phys.msu.ru/ )

RAPID COMMUNICATIONS PHYSICAL REVIEW A, VOLUME 62, 011802 R High-intensity pulsed source of space-time and polarization double-entangled photon pairs Yoon-Ho Kim,* Sergei P. Kulik, and Yanhua Shih Department of Physics, University of Maryland, Baltimore County, Baltimore, Maryland 21250 Received 4 April 2000; published 13 June 2000 Two spatially separated type-I nonlinear ... Two orthogonally oriented type-I BBO crystals are placed collinearly and pumped by 45° polarized femtosecond pulses. ...

Еще в разделе: (Показать все результаты (>80) - qi.phys.msu.ru/ )

• http://qi.phys.msu.su/papers/2006-jetp(e)-102-712.pdf
• http://qi.phys.msu.ru/papers/2011-jetp(e)-112-20.pdf
• http://qi.phys.msu.su/papers/2006-pra-73-063810.pdf

Communicating Through Art, L.Vershbow . ... But here I am, and as a designer, I will attempt to explain to you how I perceive art and design as a form of communication. Most of us think of art as the works that hang in museums and on the walls of our homes. ... But art, design and symbols, whether they are aesthetically pleasing or not, are all around us, and they help to guide us through the complexities of everyday society. ... Today I am a designer and creator of contemporary jewelry. ...

Еще в разделе: (Показать все результаты (>9) - suny.msu.ru/ )

... Keywords: anthropology, craniotrigonometry, skull angular morphometry, the Russian Imperial Romanov family, shaping angles parameters Sviridov A.A. Cranial study of population of Loyalty Islands (Melanesia) (p. 88) The aim of this work is to study cranial series of 67 skulls from the Loyalty Islands (Northern Melanesia), stored at Musee de l'Homme (Paris, France). ... The study of intragroup variability showed a difference in the cranial types of the population of the Lifou and Mare islands. ...

Еще в разделе: (Показать все результаты (>26) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2014_1.doc
• НИИ и Музей антропологии | Вестник Московского университета. Серия XXIII.

... Cancellation policy for all excursions: The cancellation of the tours before May 22, 2013 - no penalty. ... Time : will be announced soon . The price includes : transfer Moscow-Suzdal-Moscow, 1 night accommodation, meals according to the program, entrance tickets, English speaking guide. Suzdal is a calm old Russian town situated 220 km north-east of Moscow, 38 kilometers north from the city Vladimir, on the Kamenka river. ... Tour program: . ... Excursion to State Tretyakov Gallery . ...

Еще в разделе: (Показать все результаты (>11) - iconolat13.phys.msu.ru/ )

• Invited speakers
• Symposia

Международный учебно-научный лазерный центр МГУ им. М.В. Ломоносова . ... О МЛЦ МГУ . ... Абстракт: The current status of studies in the physics of entangled states of atomic systems Р an interdisciplinary field involving quantum optics, quantum information, and the foundations of quantum mechanicsРis reviewed. ... In the second part, experiments on the creation and detection of entangled states in atomic systems are discussed along with associated experimental proposals for their refinement. ...

Еще в разделе: (Показать все результаты (>141) - ilc.phys.msu.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>2) - npidb.belozersky.msu.ru/ )