... hall in front of room 01, MSU, Main Building . ... room 01, MSU, Main Building . ... Silvia Chelala (Empire State College, State University of New York, Old Westbury, New York, USA) Designing and Teaching Introductory Spanish as a Foreign Language at a Distance . ... FFL, recreation hall, 3rd floor . ... FFL, room 519 . ... FFL, room 501 . ... FFL, . room 107-108 . ... Internet-Supported Teaching . ... FFL, room 106 . ... FFL, room 416 . ... FFL, room 420 . ... FFL, room 210 . ...

Еще в разделе: (Показать все результаты (>11) - anazarenko.ffl.msu.ru/ )

• Факультет иностранных языков МГУ. Дистанционные подготовительные курсы

... Electronic journal Issue 4. 10 september 2004 Briedis V. Pareto Structures A great Italian economist Vilfredo Pareto (1848 ­ 1923) in his unique economics and sociology studies [1, 2] continuously emphasised the systematic approach, reviewing the society development problems. ... Formal model of Pareto Structure First of all, provide a formal mathematical model adequately featuring the Pareto Structure. ... Indeed, I was primarily interested in the classical (harmonic structure) model at s = 1. ...

Еще в разделе: (Показать все результаты (>10) - e-journal.spa.msu.ru/ )

• Государственное управление. Электронный вестник

pic] L'UniversitИ d'Etat de Moscou Lomonossov (MGU) La facultИ des langues ИtrangХres et des rИgions a le plaisir de vous inviter Ю la 5e confИrence internationale « Technologies de l'information et de la communication dans la linguistique, la didactique des langues et l'interculturel» les 7 et 8 juin 2012 Ю Moscou. ... Les T.I.C. dans les recherches linguistiques. ... Les aspects didactiques de l'enseignement des langues ИtrangХres Ю distance. ... Les ressources d'Internet dans l'enseignement. ...

Еще в разделе: (Показать все результаты (>5) - dist.ffl.msu.ru/ )

http://www. econorus.org/sub.phtml?id=71 .. « ». « ». « «» (14 )», .. . ... Quarterly Journal of Econo mics, Review of Economic Studies, Journal of European Economic Associat ion, American Po lit ica l Science Review, American Journal of Po lit ical Science. 1990 . ...

Еще в разделе: (Показать все результаты (>22) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/Ayvazyan_Introduction_to_the_textbook_on_econometrics.pdf
• http://www.mse-msu.ru/CV_Edoardo_Reviglio.pdf

Information Projects Detectors Staff Publications Contacts . ... Ahn H., Bashindzhagyan G.L., Kuznetsov E.N., Voronin A.G., et al ., ... April Meeting, Jointly Sponsored with the High Energy Astrophisics . Division (HEAD) of the American Astronomical Society, . April 20-23, Albuquerque , New Mexico , USA , Abstracts, . 2002, p . ... Gunasingha R., Bashindzhagyan G.L., Kuznetsov E.N., Voronin A.G., . ...

Еще в разделе: (Показать все результаты (>3) - silab.sinp.msu.ru/ )

... David Kirk/NVIDIA and Wen-mei W. Hwu , 2007-2012 ECE408/CS483, University of Illinois , Urbana-Champaign 14 CUDA Device Memory Management API functions · cudaMalloc() ­ Allocates object in the device global memory ­ Two parameters · Address of a pointer to the allocated object · Size of of allocated object in terms of bytes ( Device ) Grid Block (0, 0) Block (0, 1) Registers Registers Registers Registers · cudaFree() ­ Frees object from ...

Еще в разделе: (Показать все результаты (>3) - ccoe.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• ConClus

... Aerodynamic unit AR-3 is used for experimental research of heat and mass exchange in the boundary layer of models flown over by supersonic gas flow (air, argon, helium, etc). ... Unit parameters. Unit AR-3 is a supersonic aerodynamic tube with continuous performance and axial-symmetric working part. ... Experimental research carried out on the small flow rate supersonic aerodynamic unit 'AR-3'. ... View of the working part of small flow rate supersonic aerodynamic unit 'AR-3' ...

Еще в разделе: (Показать все результаты (>10) - termogaz.imec.msu.ru/ )

International Laser Center of MSU . ... Education . ... 06.10.2014 . October 10, 2014 . 15:00 S.A. Akhmanov Hall, KNO . ... 20.09.2009 . ... 15:00 S.A. Akhmanov Hall, Nonlinear Optics Bld. ... In our work we have obtained analytical expressions, which describe the distributions of intensity and polarization in the cross-section of a second-harmonic (SH) light beam. It is found that the polarization state drastically changes along the cross-section of the signal light beam. ...

Еще в разделе: (Показать все результаты (>57) - ilc.phys.msu.ru/ )

• Публикация
• Visit from the National Taiwan University of Science and Technology
• Setup for high-resolution luminescence spectroscopy

... ECOLOGICAL COOPERATION" . ... Brjanskaja oblast, Dubrovskij rajon, Seshcha (village), School . Brjanskaja oblast, Djat'kovskij rajon, Bytosh (village), School . ... Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Borodino (village), School . Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Yardenikha (village), School . ... Moscow, Children's Ecological Center of the National Park "Losinyj Ostrov" - the coordinator of ecological work of 18 Korolev-town's schools . Moscow, School #222 . ...

Еще в разделе: (Показать все результаты (>8) - www.ecocoop.ru/ )

... В.Е.Юрасова, Современные теории катодного распыления и микрорельеф распыляемой поверхности металла, ЖТФ, 1958, 28, ?9, 1966-1970. ... V.I.Shulga, I.G.Bunin, V.E.Yurasova, V.V.Andreev, B.M.Mamaev, Influence of surface semichannels on ion scattering by crystals, Phys. Lett., ... Рентгеновские, синхротронные и нейтронные исследования, 2000, ? ... Особенности распыления сплавов Ni-Pd с разным содержанием компонент, Поверхность - рентгеновские, синхротронные и нейтронные исследования, 2006, ?7, 13- 17. ...

Еще в разделе: (Показать все результаты (>4) - physelec.phys.msu.ru/ )

• http://physelec.phys.msu.ru/staff/zykovapubl.doc
• http://physelec.phys.msu.ru/staff/bychkovpubl.doc

Ultraviolet data (DUV) . ... The section "Original data" contains original information in analogue-digital and digital- analogue codes. The section "Data for analysis" contains pre-processed data for further analysis. Tatiana" program can be used for graph presentation of the experimental data, and "Orbitron" program - for geographical control of the data. Manual on how to use the programs and the data is in the HELP-file. ... Original data . Data for analysis . Tatiana program . ...

Еще в разделе: (Показать все результаты (>41) - cosmos.msu.ru/ )

• Space Scientific and Education project of Lomonosov Moscow State University -
• Brief report about the conference "University Satellites and Space Science
• University Satellites and Space Science Education '2006

... OpenMP. ... lastprivate lastprivate , private. , work-sharing . ... pragma omp parallel default(private) shared shared . ... setenv OMP _SCHEDULE guided,4 #include omp .h #define CHUNK #define N main () { 10 100 int nthreads, tid , i, n, chunk ; float a[N], b[N], c[N]; for (i=0; i N; i++) a[i] = b[i] = i * 1.0; n = N; chunk = CHUNK ; # pragma omp parallel shared (a,b,c,n, chunk ) \ private (i,nthreads, tid ) { tid = omp _get_thread_num(); # pragma omp for schedule(dynamic...

Еще в разделе: (Показать все результаты (>2) - angel.cmc.msu.ru/ )

ANCIENT RECORDS UNDER ATTACK . ... Robert Russell Newton is an American physicist who has made himself known to historians of astronomy by publishing a number of critical commentaries on early astronomical records. ... Newton's practice is to publish his scientific conclusions in book form, including annotated descriptions of the historical data on which his arguments are based. ... That is the way I shall use Newton's books. ...

Еще в разделе: (Показать все результаты (>91) - hbar.phys.msu.ru/ )

• Michael L. Gorodetsky
• R. R. Newton, "Two uses of ancient astronomy"
• Владимир Борисович Брагинский