Lomonosov Moscow State University was established in 1755 . ... Lomonosov Moscow State University Diary . ... MSU Web Sites . ... Faculties . ... Study and Research . ... MSU Online . ... Faculty of Physics . Faculty of Chemistry . ... Faculty of Soil Science . ... Faculty of Materials Science . ... MSU-RAS Research Institute of Soil Science . ... Research Priorities in Sciences at MSU: . ... Lomonosov Moscow State University . ... Copyright 1997?2016 Lomonosov Moscow State University . ...
... We designed a prototype of a direction-sensitive optical mo dule (DOM) and we accordingly mo dified the simulation and reconstruction codes [2] currently used by the ANTARES Collaboration to study the response of the detector. The DOM is based on a position-sensitive photomultiplier coupled to a light guide system such that all the Cherenkov light arriving from the same direction is fo cussed on a reduced area of the photo catho de. ... Left: standard optical module; right: DOM. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Написать комментарий . ... В наружном кольце преобладают яркие голубые звезды, а в центре находится шар из гораздо более красных звезд, которые, вероятно, значительно старше. ... Спиральная галактика с перемычкой NGC 1365 это действительно величественная островная вселенная, размер которой около 200 тысяч световых лет. ... Это скопление, известное также под именем Каппа Южного креста, насчитывает свыше ста звезд, а его возраст составляет около 10 миллионов лет. ...
Index of Journals and Publishers . You can find some material through alphabetical list, here are publisher's and journal's lists. ... Main journals" list contains the most significant science magazines, like Nature , Cell , Science , PNAS and etc.. Physico-chemical biology" list contains magazines whitch is used very often by biologists of Belozersky institute, it had been gathered by Vladimir Melgunov. The "Classification" allows you to watch all journal in specific category. ...
... Run source ./setup.csh 6. ... When you will start to work next time, run setups in following order : cd /data1/atlas/work source ../software/12.0.8/setup.csh cd testarea/12.0.8/ source $ATLAS_ROOT/../work/cmthome/setup.csh -tag=12.0.8 To exclude first two lines, just add to your .login these lines : # add Atlas env-s : source /data1/atlas/software/12.0.8/setup.csh After that next time just do : source $ATLAS_ROOT/../work/cmthome/setup.csh -tag=12.0.8 cd /data1/atlas/work/testarea/12.0.8/ . ...
trendence Graduate Barometer Europe 2011 About the survey About trendence trendence Graduate Barometer Europe is an annual online student survey which allows students to express their opinion on topics re lated to career and education. ... Ulrike Heyne Project Manager trendence Graduate Barometer Europe 2011 About the survey Facts and benefits How does it work? ... If your students take part in the trendence Graduate Barometer, they will receive an exclusive Student Report. ...
[
Текст
]
Ссылки http://studsov.math.msu.su/Sites/studsovet/Uploads/trendence_GBE_2011_-_About_the_survey.docs1.pdf -- 209.6 Кб -- 20.10.2012 Похожие документы
Партнерская программ CRDF . 2003 Cooperative Grants Program . The U.S. Civilian Research and Development Foundation (CRDF) is pleased to announce a new competition for its Cooperative Grants Program. This program allows joint teams of U.S. and former Soviet Union (FSU) scientists and engineers to apply for one- to two-year support for cooperation in any area of civilian research and development in the natural sciences, mathematics, engineering, and biomedical and behavioral sciences. ...
This domain may be for sale - этот домен возможно продается . ... The gathered information about your visits to this and other websites are used by these third party companies in order to provide advertisements about goods and services of interest to you. ... If you would like more information about this practice and to know your choices about not having this information used by these companies, click here . ...
Support Vector Machines in Analysis of Top Quark Production Anthony Vaiciulis University of Rochester Advanced Computing and Analysis Techniques June 24, 2002, Moscow introduction SVM method separable linear problem (hyperplane classi ers) separable nonlinear problem (feature space and kernels) nonseparable nonlinear problem top quark study Introduction Common HEP ... no correct underlying classi cation function? ! ... no linear separation in fea- ture space. ...
[
Текст
]
Ссылки http://acat02.sinp.msu.ru/presentations/vaiciulis/acat2002.ps -- 312.9 Кб -- 26.06.2002 Похожие документы
... 247th American Chemical Society National Meeting and Exposition "Chemistry and materials for energy" , March 16-20, Dallas, TX Talk: A.V. Nemukhin "QM/MM-based modeling of structure and spectra of fluorescent proteins" . ... IV International Symposium "Topical Problems of Biophotonics", July 21-27, Nizhny Novgorod Invited talk: M.G. Khrenova , A.V. Nemukhin, A.P. Savitsky "Molecular modeling of the Forster resonance energy transfer between fluorescent proteins" . ...
JOURNAL OF APPLIED PHYSICS VOLUME 96, NUMBER 1 1 JULY 2004 Theoretical analysis of the synergism in the dielectric strength for SF6 у CF4 mixtures A. V. Larin ґ Laboratoire de Physico-Chimie Informatique, Facultes Universitaires Notre-Dame de la Paix, Rue de Bruxelles 61, B ... Calculated electron energy distribution function EEDF for the SF6 /CF4 mixture solid lines and a pure CF4 dashed lines or b pure SF6 dotted lines vs the electron energy under the same E / N values as given in Table IV. ...
... Parts 3 and 4 give details of the ERC grant schemes, submission and evaluation while Part 5 lists other activities to allow the Scientific Council of the ERC to carry out its duties. ... 3.5 ERC Starting Grant proposal description .. 3.6 ERC Starting Grant proposal submission procedure and peer review evaluation .. ... The proposal must be submitted to the appropriate primary ERC panel (i.e. the panel which covers the main scientific areas of the research proposed) before the respective deadline. ...
Proceedings of ICHIT- 06 26 February - 5 March 2006, Moscow, Russia LINEAR AND NONLINEAR ANALYSIS OF NUMERICAL METHOD FOR DNS OF TURBULENT CONVECTION IGOR B. PALYMSKIY Modern Academy for Humanities, Novosibirsk Branch , Novosibirsk, Russia, 630064 palymsky@hnet.ru Abstract We study the spectral characteristics of the numerical method for DNS of turbulent convectional flows. ... So far the full numerical simulation of 3-D turbulent convection is very complex problem demanding the large resources. ...
The Department of Talented Youth Affairs and Professional Orientation . ... Center for Intellectual Reserve MSU paid trips to the Summer research and academic school of five students who successfully complete initial research projects. ... In MSU Summer School he will improve their skills under the guidance of experienced mentors. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...
... О Центре . Информация о Центре . ... Электронные платежи . ... Видеоархив МГУ . ... д.б.н., профессор Г.В.Максимов . ... Современные экологическиељ проблемы и устойчивое развитие? . ... Язык, культура иљ межкультурная коммуникация? . ... Минеральные ресурсы и цивилизация? . ... Команда Центра развития электронных образовательных ресурсов. ... Курс подготовки иностранных граждан к комплексному экзамену по русскому языку, истории России и основам законодательства РФ . ... Log in with Google . ...
Способы и средства нейтрализации аварийных разливов нефти в условиях низких температур Якутии Ways and means of oil-spill recovery in the low temperatures conditions of Yakutia / Попов С.Н., Морова Л.Я., Ефимов С.Е., Герасимов А.И // Нефтегазовое дело, 2011. ... 184-191. ... Показана перспективность использования в технологиях по локализации и сбору разливов нефти отечественного нефтесорбента "ЭКОСОРБ". ... нефтепроводы, разлив нефти, ликвидация последствий, нефтепродукты . ...
... PhD . ... Home News PhD Defence . ... The title of the research project is љ"Physical-chemical properties of the gas phase in the ureaљproduction processљunder conditions of the Bazarov's reaction" . Colloquium on 13.05.10 . ... Colloquium on 24.12.12 20 Dec 2012 . ... Colloquium on 23.11.12 22 Nov 2012 . ... Lomonosov Moscow State University . Department of Chemistry . ... Laboratory of Chemical Thermodynamics . ... 2000-2016 Laboratory of Chemical Thermodynamics . ...
ORF ALEA CENTER FOR GL OB AL INTERNA TIONAL S TUDIES UNIVERSIT Y OF C ALIFORNIA, SANT A BARBAR A THE ROLE OF RELIGION IN GLOBAL CIVIL SOCIETY: THE MOSCOW WORKSHOP Lomonosov Moscow State University Moscow , Russia June 19, 2013 Sponsored by the Henry R. Luce Initiative on Religion and International Affairs Luce Moscow Workshop The Moscow workshop for the Or falea Center 's Luce Project on religion in ... Moscow State University has its own church of the Saint Tatiana. ...
[
Текст
]
Ссылки http://fgp.msu.ru/wp-content/uploads/2013/12/Luce_Moscow_2013_small.pdf -- 1404.9 Кб -- 22.12.2013 Похожие документы