... Moscow State University Belozersky Institute of Physico-Chemical Biology . The Department of Electron Microscopy offers positions in the area of molecular biology of the cell for excellent and highly motivated biologists at under-graduate or post-graduate level. Students : We are constantly offering diploma thesis and PhD thesis projects for students in cell biology and biophysics. The applicant is expected to have a strong interest in either experimental activity or computer modeling. ...

Еще в разделе: (Показать все результаты (>2) - cellbiol.genebee.msu.ru/ )

docs ]] . CompHEP . Trace: docs . ... E.E.Boos, M.N.Dubinin, V.A.Ilyin, G.V.Jikia, A.E.Pukhov, S.F.Sultanov, Associated Higgs boson production in $\gamma e$ collisions, Puzzles on the Electroweak Scale. ... E.E.Boos, M.N.Dubinin, V.F.Edneral, V.A.Ilyin, G.V.Jikia, A.E.Pukhov, V.I.Savrin, S.A.Shichanin, S.F.Sultanov, Physics on future $\gamma p$ and $\gamma e$ colliders at TeV energy scale and computer system CompHEP, DESY report 91-114, Hamburg, 1991, 24p . ... Higgs boson production . ...

Еще в разделе: (Показать все результаты (>13) - comphep.sinp.msu.ru/ )

• news [CompHEP]

... Energy gain spectroscopy and the related experiments in inverse kinematics which exploit the recoil ion longitudinal momentum for Q -value determination (change in the electron binding energies) give access to the energy levels of highly charged species and to energy levels that do not decay radiatively. ... Especially at higher impact energies Ep > 100 keV/u, where the final state determination in experiments are difficult, the influence of excitation has not been investigated. ... Phys. Rep. ...

Еще в разделе: (Показать все результаты (>8) - lmmqsp.sinp.msu.ru/ )

12'2003 : 2'2003 . ... 2.1) A -- , C -- , . 1.1) n x= i=1 hi cos(i t), (2.2) i -- , hi -- . ... M 0 0 A = 0 Izz Izx , 0 Ixz Ixx rz , rx -- OZ OX , Lz , Lx -- OZ OX (. ... M -- ; Ixx , Izx , Izz -- : 1 - rx L-1 rx L-1 - rz L-1 x x z - L -1 L= L -1 x z 0 L -1 z . ... L x z 1000 2 1.74 13.2 / 16.84 / 28.3 / -4.01 · 10 -1.44 · 10 -2.04 · 10 -6.79 · 10 -1.28 · 10 -6.61 · 10 -5.40 · 10 2.68 · 10 2.08 · 10 -4 , % 0.01 0.1 0.1 0.01 0.01 0.01 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 3. ... 2002. ...

Еще в разделе: (Показать все результаты (>11) - belyakov.imec.msu.ru/ )

• http://belyakov.imec.msu.ru/papers/PhysCon2005.pdf
• http://belyakov.imec.msu.ru/papers/Belyakov_eng.pdf
• Anton O. Belyakov

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Terrestrial ecosystems . Research . ... Environmental pollution and protection in the Norwegian-Russian border area are the main themes of research cooperation between the Soil Science Faculty of Moscow State University (MSU) and the Norwegian Forest Research Institute (NISK). ... The bilateral scientific cooperation between Norway and Russia was established in 1988, based on joint governmental agreement on environmental problems. ... Norwegian Forest Research Institute, Norway . ...

Еще в разделе: (Показать все результаты (>13) - eco.soil.msu.ru/ )

• ASSESSMENT OF SOIL SUSTAINABILITY TO ACID DEPOSITION
• Acid Deposition and Forest Soils. Eds. V.Nikonov G.Koptsik
• Forest Soil Response to Acid Deposition

... Abstract A Uniform Resource Identifier (URI) is a compact string of characters for identifying an abstract or physical resource. ... This document defines a grammar that is a superset of all valid URI, such that an implementation can parse the common components of a URI reference without knowing the scheme-specific requirements of every possible identifier type. ... URI-reference = [ absoluteURI | ... Otherwise, the reference URI's scheme is inherited from the base URI's scheme component. ...

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1808.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1945.txt

... Сектор информатики и биофизики сложных систем . ... О секторе . ... Учебная работа сектора включает лекции, семинары, практические занятия по информатике и математическому моделированию в биологии, биофизике, экологии на всех 5-ти курсах обучения на кафедре биофизики. ... Диффузия и взаимодействие белков в биологических мембранах? консультанты Ризниченко Г.Ю. , Рубин А.Б. Рабочие семинары сектора информатики и биофизики сложных систем проходят по четвергам в 11:00 в аудитории 124 (компьютерный класс...

Еще в разделе: (Показать все результаты (>10) - www.biophys.msu.ru/ )

... GOES corrected results are wrong, because the publication Smart D.F. and M.A. Shea, Comment on the use of GOES solar proton data and spectra in solar dose calculations, Radiation Measurements 30 (1999) 327-335 was erroneous (see "The issues...." above. ... The criticism of the use of the log-normal distribution for the data fit in Feynman et al. is excessive. Indeed, Feynman et al. use only the high intensity part for the fit making the results almost independent of the low energy part. ...

Еще в разделе: (Показать все результаты (>7) - srd.sinp.msu.ru/ )

• Rikho Nymmik

Audax ZP Mabulla Middle Pleistocene Lithic Industry and Hominin Behaviour at Laetoli, northern Tanzania Abstract Traditionally, insights into hominin technology, behaviours and activities are mostly inferred from the analysis of stone artifacts. Cognition, once thought to be determined by brain size and complexity alone, can now also be measured by examining the relationships between core reduction strategies, tool types and lithic raw material utilizations and procurement strategies. ...

Еще в разделе: (Показать все результаты (>22) - www.anthropos.msu.ru/ )

• НИИ и Музей антропологии | Вестник Московского университета. Серия XXIII.

SOLID SOLUTIONS IN THE REALM OF MINERALS V. S. URUSOV A majority of minerals is not pure substances, but complex mixtures - solid solutions. ... унй нДдйЦ нЗЦкСхЦ кДлнЗйкх? 54 ї м ЫТУ, З.л., 1996 , , -, , -, . лйкйлйЗлдав йЕкДбйЗДнЦгъзхв ЬмкзДг, <11, 1996 ( ) . ... Fe (Mn, Co, Ni) ZnS Zn FeS. ... мкмлйЗ З.л. нЗЦкСхЦ кДлнЗйкх З еакЦ еазЦкДгйЗ 55 . ... 4]. дДд Згаьын нЦеиЦкДнмкД а СДЗгЦзаЦ зД ийЗЦСЦзаЦ нЗЦкСхп кДлнЗйкйЗ? , , (), , , 1 , 0њ. / () 58 лйкйлйЗлдав йЕкДбйЗДнЦгъзхв ЬмкзДг, <11, 1996 . ...

Еще в разделе: (Показать все результаты (>29) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/courses/crchem/urusov2.pdf

On synthesizing impulsive controls and the theory of fast controls Aleksandr B. Kurzhanski Moscow State University, Moscow, Russia e-mail: kurzhans@mail.ru, kurzhan@cs.msu.su The report deals with the problem of constructing closed-loop (feedback) controls for systems that allow impulsive control inputs described through generalized "delta" functions and their derivatives. Such problems, having had a serious applied motivation, were mostly considered within the framework of open-loop control. ...

Еще в разделе: (Показать все результаты (>29) - pont2008.cmc.msu.ru/ )

• http://pont2008.cs.msu.ru/files/en/abstracts/Gaifullin.pdf
• Optimal Control and Differential Games. Poster session Международная
• On mathematical creative work of L.S. Pontryagin (By D.V. Anosov) International

... It is shown that their chemical activity , crystal structure and other properties dramatically depend on fluorine atomic structure and on characteristics of chemical bonds in fluorides. ... 1886 F2 CaF2 ( ) . ... F (NaHF2 , KHF2 , NH4HF2 ­ ), (, HF H2O - 36° ), ( HF), : - HF + aq H+·aq + F -·aq + HF2 ·aq (HF)nF -·aq, n = 2­4 , - KF + HF K+ + HF2 , - SbF5 + HF H2F+ + SbF6 , 3HF - HF2 + H2F+ ( ) .. ... CaF2 . ... 1986. ... BeF2 (), Al2O3 + Na3AlF6 (), () ZrF4 (HfF4) () K2ZrF6 (K2HfF6) (), K2TaF4 (). ...

Еще в разделе: (Показать все результаты (>21) - www.inorg.chem.msu.ru/ )

• The Sheelkov group
• Inorganic Chemistry Division

Pod-Moscowny . Moscow-Regional) . Branch . ... Moscow State University . Page in Russian . Moscow-Regional Branch of M.V.Lomonosov Moscow State University was founded in 1996 in Chernogolovka , town for science and education, placed in 40 km to the North-East from Moscow-city border. Chernogolovka today is considered to be one of the most important Russian scientific and educational centers in physics and chemistry . ... Branch of Moscow State University, . ... Russian Federation . ...

Еще в разделе: (Показать все результаты (>9) - www.issp.ac.ru/ )

... Abstract A. V. Dmitriev, A. V. Ivanov, A. R. Khokhlov, Numerical simulation of light propagation through a diffuser, Fundamentalnaya i prikladnaya matematika, vol. 15 (2009), no. 6, pp. ... In this article, the light propagation in a diffuser with optically soft inclusions is described with the help of the Fokker--Planck equation, i.e., a transfer equation with a diffusion term in the space of radiation propagation directions. ... 8, 9] , x1 , : 1 D = (3 - x1 ), 6 3 x1 = 2 d x( )cos sin . ...

Еще в разделе: (Показать все результаты (>16) - lizard.phys.msu.su/ )

• Condensed Matter Theory: Index

. ПО КУ . Ссылки . Статьи и тезисы . Интернет . Литература . CVS-репозитории . Утилиты . Доступ к информации . Linux SAL Parallel Computing Page . http://suparum.rz.uni-mannheim.de/docs/ind.html . Partial evaluation for MPI optimization . Berkeley Reserach Areas . IOZone filesystem benchmark . SEL-HPC Article Archive . $Date: 2000/10/12 01:09:52 $ . Home . Andrey Slepuhin .

Еще в разделе: (Показать все результаты (>4) - cluster.msu.ru/ )

• Литература

About BAFIZ . BAFIZ at SINP MSU . Bafiz' Information Resources at SINP . ... Information Services . ... Space Physics Information Home Page . The Centre for Photonuclear Experiments Data (Centr Dannykh Fotoyadernykh Eksperimentov, CDFE)" . Data Services . Data Base of Low Altitude Space Radiation Environment (DB LASRE SINP MSU) . Space Physics Data Archives . Space Physics Data On-Line Services . ... This Page is developed at Laboratory of Computational Mathematics, . ...

Еще в разделе: (Показать все результаты (>5) - dbserv.sinp.msu.ru/ )

Russian abstract] . Russian full text] . The classifications revealed by geometric morphometry and classical morphometry for Drosera rotundifolia , D. obovata , D. anglica and D. linearis were compared. ... the form of petiole middle part transverse section is the effective distinguishing character for the some different species and inter-species hybrids of Drosera ; . the consensus configurations are preferable for the geometric morphometry analysis of populations. ...

Еще в разделе: (Показать все результаты (>163) - herba.msu.ru/ )

• Morphological differences of Nymphaea alba L
• Alders in the European Russia
• The Linnaean Collection of the Herbarium of Moscow State University: digital

Lomonosov project . ... Mikhail Lomonosov . ... The studies of Lomonosov determined profile of Russian science forever, and we appreciate the discoveries of the leading Russian scientists as the studies of his direct learners and successors. A recognized and the most significant input of Lomonosov into natural science is molecular-kinetic theory of heat, developed during the prevalence of theory of specific fiery matter ? ... Lomonosov?s theory drawn wide response in European science. ... Aurora. ...

Еще в разделе: (Показать все результаты (>8) - lomonosov.sinp.msu.ru/ )

• DEPRON | Университетский спутник "Ломоносов"

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>15) - mph.cmc.msu.ru/ )

• http://mph.cs.msu.ru/mph/pap/txt/fedotov.doc
• http://mph.cs.msu.ru/mph/pap/txt/mizotin.doc
• MPH-CMC-MSU