... Department of Vertebrate Zoology . PhotoGallery 'Field Practice at the White Sea' . The White Sea Biological Station is located on the very coast of Kandalaksha Bay of the White Sea. ... The Vertebrate Zoology course with Dr. Sergei V. Ogurtsov (assoc. prof. of the Department of Vertebrate Zoology) describes the biodiversity and the variety of ecological groups of vertebrates of the White Sea region through the methods of species recognition by songs, tracks, fecal pellets etc. ...
... MOLECULAR SPECTROSCOPY The Effect of Hydration of Ions of Inorganic Salts on the Shape of the Raman Stretching Band of Water S. A. Burikov, T. A. Dolenko, P. A. Velikotnyoe, A. V. Sugonyaev, and V. V. Fadeev Moscow State University, Moscow, 119992 Russia Received April 23, 2004 Abstract--The shape of the Raman stretching band of water molecules in aqueous solutions of electrolytes KBr, KCl, KI, NaCl, and NaI is studied. ... We used high purity grade and reagent grade salts. ...
[
Текст
]
Ссылки http://rswater.phys.msu.ru/en/articles/before%202008/OptSpec2005.pdf -- 227.3 Кб -- 11.11.2013 Похожие документы
... The Field of Radiative Forces and the Acoustic Streaming in a Liquid Layer on a Solid Half Space V. A. Gusev and O. V. Rudenko Faculty of Physics, Moscow State University, Moscow, 119991 Russia e mail: vgusev@bk.ru Received May 21, 2010 Abstract--The acoustic field and the field of radiative forces that are formed in a liquid layer on a solid sub strate are calculated for the case of wave propagation along the interface. ... Let us consider the field in the liquid layer h < z < 0. ...
[
Текст
]
Ссылки http://acoustics.phys.msu.su/teachers/gusev_files/nano1.pdf -- 348.7 Кб -- 07.11.2012
[
Текст
]
Ссылки http://acoustics.phys.msu.ru/teachers/gusev_files/nano1.pdf -- 348.7 Кб -- 07.11.2012 Похожие документы
A GENETIC ALGORHYTM FOR OPTIMIZING A NEURAL NETWORK CAPABLE TO LEARN FOR FOOD SEARCHING IN A RADIAL MAZE Budilova E.V., Chepurnova N.E., Chepurnov S.A, Teriokhin A.T. M.V.Lomonosov Moscow State University, Dept. of Biology. ... The upper platform has a hole in the middle and several radially directed tubular canals ("arms") each of which can contain a peace of food and has doors opening only in the centrifugal direction. ... The task of the animal is to visit only those arms which contain food. ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2001_RadialMaze.doc -- 28.0 Кб -- 16.03.2009 Похожие документы
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
... Chilingarian, I., Melchior, A.-L., Zolotukhin, I. 2010: Analytical approximations of K -corrections in optical and near-infrared bands , MNRAS, v. 405, p. 1409 (also arXiv:1002.2360) . ... Calculator . ... calculate spectral energy distributions , K-corrections calculator , UKIDSS YJHK , K-corrections of galaxies , spectral based k-corrections , SDSS filter set K-corrections , K correction code IDL , kcorrect IDL C , . ...
... Home . ... About the project . ... Financing . Main grant . ... Scientific results . ... In late 2014 the Moscow State University signed an agreement # 14-50-00029 with the Russian Science Foundation to perform scientific works on the theme "Scientific basis for the creation of the National depositary bank of living systems". Financing: total 750 million rubles, including: 300 million rubles in 2015 and 150 million rubles per 2016-2018 years. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Neutrino-helium ionizing collisions: Electromagnetic contribution Konstantin A. Kouzakov1;2, Yulia A. Rodina1, and Alexander I. Studenikin 1. Department of Nuclear Physics & Quantum Theory of Collisions, Faculty of Physics, Lomonosov Moscow State University, Moscow 119991, Russia 2. ... The Feynman diagram illustrating how the electron neutrino can interact with an external electromagnetic field. ... High Energy Phys. 2012, 459526 (2012) [2] A. G. Beda et al., ... Phys. At. ...
... Information for the applicants . ... News . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Faculty of Bioengineering and Bioinformatics, office 433. ... 2016 Faculty of Bioengineering and Bioinformatics, . Lomonosov Moscow State University . ...
... Multi-threaded search engines . ... Unfortunately, most documents on search engines I saw in the Internet were either lists of hyperlinks without any comments, or discussions about how many documents are in the database of ... (here is the name of a search engine) and what method of counting of the number of documents was used. No words about the efficiency, i.e. how many documents on some subject I can find using this search engine, especially in comparison with the other ones. ...
... Site is discontinually updating by professional biologists and students of biology faculty of MSU. ... Whole publisher list . This list contains all the publishers related to at least one journal from main database. ... If there is no action when clicking then no publishers begins from this letter. Set the mouse cursor on any letter and you will know the number of journals; gray letter means that no publishers begins from it. ... View whole publisher list(435) . JCatalog | Index | ...
... взаимодействие языка и культуры в контексте сравнительно-исторических исследований; . ... The Philology Faculty of Moscow State Lomonosov University will hold the VIII International Scientific Conference on Comparative-Historical Linguistics 'Modern methods of comparative historical research', from 25 to 27 September 2013, which is traditionally organized by the Department of General and Comparative-historical linguistics. ... History of Comparative Linguistics. ...
... The field of the fast first pulse is mainly localized within low refractive index layers, whereas the slow second pulse field is mostly in high refractive index layers. ... In the PC, each spectral component of a pulse incident at the Bragg angle with respect to the PC layers splits up into a coherent superposition of two transmitted and two diffracted diffractively reflected waves. ... The first pulse is formed by the waves E01 and Eh1, whereas the second one is formed by waves E02 and Eh2. ...
... about ERC . education . research . ... The Lomonosov Moscow State University (MSU) has been training specialists in nanotechnology, nanomaterials and nanosystems for nearly ten years . ... MSU Nanotechnology Education and Research Center (ERC) was established to consolidate efforts of MSU units aimed at research and development and true cross-disciplinary education in nanotechnology, nanomaterials and nanosystems. ... Fundamentals of Nanotechnology? was the first step in ERC?s activity. ...
... О хоре . История хора . ... Выступление Академического хора МГУ в Крокус Сити Холле . ... Епископ Тихон открыл выступление хора МГУ в Вене . Хор МГУ выступил в Венском отделении ООН . Выступление хора на торжественном открытии Международного научного конгресса ?Глобалистика ? 2015? ... Академический хор Московского государственного университета имени М. В. Ломоносова . ... Прослушивания состоятся в течение всего сентябряљв 311 и 316 классах Культурного центра МГУ в 18-30 . ...
... The applied mathematics (with Honors), Kazan State University, Kazan, Russia (USSR), 1980. nd Alexander Lazarev Research Interests Discrete optimization: combinatory problems, modeling, decomposition algorithms, applications to production planning and scheduling. ... Kazan, Publishing house of the Kazan mathematical society, 1998. - 285 p. Lazarev A.A., Gafarov E.R. Scheduling Theory. ... Computer centre of the Russian Academy of Sciences - 2006. - 134 p. Lazarev A.A., Gafarov E.R. Scheduling Theory...
[
Текст
]
Ссылки http://physcontrol.phys.msu.ru/materials/aal/CV_Lazarev_2012.pdf -- 455.1 Кб -- 15.05.2014 Похожие документы
Home page: http://srd.sinp.msu.ru/nymmik/ . E-mail nymmik@sinp.msu.ru . ISO TS15391 Memorandum, October 2004 . ISO TS15391, version 2004, October . Report on the ISO WG4 meeting 24.05.2004 . Replies to comment from . G. Bazilevskaya - 1 , 2 . B. Quaghebeur - 1 , 2 . A. Hilgers - . MODEL PARAMETERS (PROTONS) . fluence peak flux . From date year-month (later then 1950-1) . - . To date year-month (before 2008-1) . - . Probability (from 0.01 to 0.9) . table . plot .
... Публикации . ... 1, 012506 DOI . ... 1, 012509 DOI . ... 1, 103598 DOI . ... Edge field emission of large-area single layer graphene Kleshch V.I., Bandurin D.A., Orekhov A.S., Purcell S.T., Obraztsov A.N. Applied Surface Science, Elsevier BV (Netherlands) DOI . ... Graphene Formation on Surfaces of Single Crystal Metals Shvets P.V., Soon J.M., Verger A., Obraztsov A.N Journal of Nanoelectronics and Optoelectronics, American Scientific Publishers (United States) DOI . ... Материалы, ? ...