... PhDi . ... SOFTWARE PACKAGE FOR CALCULATIONS OF PHASE DIAGRAMS . elaborated and developed by laboratory scientists) . The software package contains a database of thermodynamic properties for about 200 systems and a software based on a so called convex hulls approach. ... binary systems in coordinates Temperature - Composition at fixed pressure and Pressure ? ... Colloquium on 24.12.12 20 Dec 2012 . ... Colloquium on 23.11.12 22 Nov 2012 . ... Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>14) - td.chem.msu.ru/ )

... References . ... References to books should include the author's name; year of publication; title; page numbers where appropriate; publisher; place of publication, in the order given in the example below. ... Ramirez, F. J., Marquez, R. A. C., and Mondaca, G.: 1991, The 1877 great tsunami and the rapid local warning network in the coast of Northern Chile - South America, In: Proc. International Conference of Australian Earthquake Engineering Society , Brisbane, Australia, 25-1. ... Information . ...

Еще в разделе: (Показать все результаты (>21) - seac47-2.phys.msu.ru/ )

VIEWS Paul Murdin M T Wright Data, information and science I was one of almost half the IAU General Assembly that voted against the IAU resolution initiated by Elizabeth Griffin in Manchester in August 2000. ... The IUE archive, for example, delivers ultraviolet spectra into the hands of the community at the same rate that the satellite itself used to do, and papers frequently appear that are based on the archive. Other space missions like ISO and XMM have and are completing similar archives. ...

Еще в разделе: (Показать все результаты (>82) - hbar.phys.msu.ru/ )

• articles on ancient observations
• njudge.htm
• Historical Eclipses

Online 2.0 http://ww w.expert.ru/articles/2010/03/15/privalov_nekipelov?esr=4 Online « Online» / 15 2010 , «» ? ... 2009 , , , 2010 , , , , , . 2010 , , 4% . ... 1 8 -- Online 2.0 http://ww w.expert.ru/articles/2010/03/15/privalov_nekipelov?esr=4 ­ 2008, 2009 2010 , . 2009 . ... 2009, 2010 , , 2002 , , ­ , . ... 2 8 18.03.2010 15:00 -- Online 2.0 http://ww w.expert.ru/articles/2010/03/15/privalov_nekipelov?esr=4 ­ ? ... 1] «- » [1] http://tv.expert.ru/video/576518/ . ...

Еще в разделе: (Показать все результаты (>22) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/AIF_Kvint_Tarif_02_2010.pdf
• http://www.mse-msu.ru/Nekipelov_France_2010_Text_Eng.pdf
• http://www.mse-msu.ru/sc_pub/fantazzini_sc_pub_2011_en.pdf

... Abstract A Uniform Resource Identifier (URI) is a compact string of characters for identifying an abstract or physical resource. ... This document defines a grammar that is a superset of all valid URI, such that an implementation can parse the common components of a URI reference without knowing the scheme-specific requirements of every possible identifier type. ... URI-reference = [ absoluteURI | ... Otherwise, the reference URI's scheme is inherited from the base URI's scheme component. ...

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1808.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1945.txt

Russian version . ... Leninskie Gory 1, Moscow, 119991, Russia . ... The title is: "The development of resonant X-ray reflectivity method near the L2,3 absorption edges for investigations of magnetic multilayers". ... Moscow. ... Russia. ... A. Smekhova, е.ю. Gan'shina, B.S. Roschin, A.D. Gribova, M.A. Andreeva, F. Wilhelm, A. Rogalev, "Structural and Magnetic Studies of [Co 0.45 Fe 0.45 Zr 0.1 /a-Si] N Multilayers", Journal of Spintronics and Magnetic Nanomaterials, 1 (1), pp.11-17 (2012) [pdf] . ...

Еще в разделе: (Показать все результаты (>8) - magn.phys.msu.ru/ )

... Publications . ... Cosmic rays of extremely high energy . ... M.I. Panasyuk. ... B.A. Khrenov. ... M.I. Panasyuk and B.A. Khrenov. Envoys of space: far or near? Ultrahigh energy cosmic rays. ... Cosmic rays of the highest energy ? ... Space Program KOSMOTEPETL (Projects KLYPVE and TUS ) for the Study of Extremely High Energy Cosmic Rays. ... KLYPVE/TUS space experiment for study of the ultrahigh energy cosmic rays.љ ... Space Detector TUS for Extreme Energy Cosmic Rays Study. ...

Еще в разделе: (Показать все результаты (>16) - lomonosov.sinp.msu.ru/ )

• Mikhail Lomonosov ? the Pioneer of Russian Science | Университетский спутник

This page could be summarized with the statement: don't require Apache to use DNS for any parsing of the configuration files . ... In order for Apache to function properly it absolutely needs to have two pieces of information about each virtual host: the ServerName and at least one IP address that the server responds to. ... use IP addresses in Listen . ... In any event it doesn't seem possible to reliably boot a virtual-hosted web server when DNS has failed unless IP addresses are used. ...

Еще в разделе: (Показать все результаты (>74) - neptun.sai.msu.ru/ )

• Running a High-Performance Web Server on HPUX
• Apache module mod_mime_magic
• Apache Tutorial: Dynamic Content with CGI

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

... Ph.D. thesis - "Continuous minimization methods with variable metric' . ... A continuous projection gradient method of second order with variable metric has been proposed, the convergence theorem was proved. ... T.V. Amotchkina, A. S. Antipin, F.P. Vasiliev Regularized continuous minimization method with variable metric for problems with inaccurate input data// Vestnik MGU, S. 15, Comp. ... T.V. Amotchkina, A. S. Antipin, F.P. Vasiliev Continuous second order minimization method with variable metric...

Еще в разделе: (Показать все результаты (>30) - www.srcc.msu.ru/ )

• Адрес

Вы посетили: conf_engl.html . ... International Algebraic Conference dedicated to 70th birthday of professor A.V. Mikhalev, Russia, Moscow, November 2010 . ... International Algebraic Conference dedicated to the 100-year anniversary of professor A.G. Kurosh, Russia, Moscow, May 2008 . ... 2nd International Conferences on Matrix Methods and Operator Equations, Russia, Moscow, July 2007 . ... staff/guterman/conf_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>17) - halgebra.math.msu.su/ )

• staff:guterman:conf_rus.html | Кафедра высшей алгебры

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

193. Teaching - Laboratory of Medicinal Chemistry

194. Об оптимальности схемы Горнера

195. Факультет иностранных языков МГУ. Центр Дистанционного обучения.

196. http://genphys.phys.msu.su/eng/

197. Кафедра математики Физического Факультета МГУ им. М.В. Ломоносова | Научная

198. http://mph.cs.msu.ru/mph/pap/txt/fedotov.doc

199. http://observ.pereplet.ru/cbet3962.html

200. CONTACTS