Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...

Еще в разделе: (Показать все результаты (>10) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~dimawolf/RTES/Lection03.pdf

... MAX, MAX], MAX = 3'812'798'742'493. . ... MEMCAP - (read only) CSP - Control Stack Pointer - CSPL - CSP Low ­ CSP - CSP High ­ DSP - Data Stack Pointer - DSPL - DSP Low ­ DSP - DSP High ­ EXC - Exception ­ (0 ­ ) PC - Program Counter ­ STATUS - . ... EXC==-3) && (STATUS[IE]==1))) { pushcs(STATUS); // STATUS STATUS[IE]=0; // pushcs(PC); // PC PC = m(IVBASE + EXC); // EXC = 0; } else // { if (ICL == 1) // IC locked, IC ICL=0; else // { IC = m(PC); PC = PC+3; } } // IC PC execute; . ... STATUS. ...

Еще в разделе: (Показать все результаты (>2) - ternarycomp.cmc.msu.ru/ )

THE ROLE OF DEVELOPING NATION TOWARDS COMBATING THE CYBER CRIME Abhishek Vaish and Satya Prakash, Indian Institute of Information Technology, Allahabad. ... Highlights on the recent trends: A report of Indian computer Emergency Response Team (CERTIN) shows that more than 2500 incidents were registered and handled in the year 2008. ... Others security incidents reported in the year 2004 was 4, in the year 2005 was 18, in the year 2006 was 17, in the year 2007 was 264 and in the year 2008 was 94. ...

Еще в разделе: (Показать все результаты (>7) - www.iisi.msu.ru/ )

• Институт Проблем Информационной Безопасности

. ПО КУ . Ссылки . Статьи и тезисы . Интернет . Литература . CVS-репозитории . Утилиты . Доступ к информации . Книга "High Performance Cluster Computing" . По этой же ссылке имеется очень интересный список ресурсов по вычислениям в кластерах. По вопросам получения жесткой копии обращаться в ЦТиТИ МГУ или Роганову Владимиру < var@msu.ru > . Новый стандарт C++, библиотека STL . Библиотека STL . $Date: 2000/10/12 01:09:52 $ . Home . Andrey Slepuhin .

Еще в разделе: (Показать все результаты (>5) - cluster.msu.ru/ )

• Интернет

... A constructive approach is proposed that allows one to determine, in a first approximation, the stability domain or a domain with a bounded decrement in the neighborhood of a singular or regular point of its boundary from the information available at this point (the roots and coefficients of the polynomial as well as the first derivatives of the coefficients with respect to parameters). ... The set of values of the vector p of parameters for which P(, p) is stable is called the stability domain. ...

Еще в разделе: (Показать все результаты (>27) - mailybaev.imec.msu.ru/ )

• http://mailybaev.imec.msu.ru/papers/Mailybaev2001b.pdf
• http://mailybaev.imec.msu.ru/papers/Mailybaev2001.pdf
• http://mailybaev.imec.msu.ru/papers/Mailybaev2005.pdf

... On-line консультант . ... Место работы, должность: Преподаватель, старший научный сотрудник Лаборатории Вычислительных комплексов ВМК МГУ имени М.В.Ломоносова . ... D. Gamayunov, R. Smeliansky. ... 2002. (in Russian) . D. Gamayunov, A. Kachalin. ... In proceedings of the fifth Russian Applied and . ... detectors of computer attacks for corporate networks. ... I. Bulgakov, D. Gamayunov, E. Toroschin, Detecting network worms . ... Опыт работы по тематике магистратуры: 9 лет (руководство . ...

Еще в разделе: (Показать все результаты (>12) - erp.cmc.msu.ru/ )

... The latter should be taken into account and carefully modeled as a fluid-structure interaction (FSI) problem. A patient- specific FSI analysis is impossible because it predicts only estimated hemodynamic features which are based on assumptions regarding material properties. The objective of this study is to develop a new methodology that assimilates medical imaging data for quantitative hemodynamic data extraction. ...

Еще в разделе: (Показать все результаты (>11) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2008/abstractEx.doc

Стратегия здравоохранения относительно загрязнения питьевой воды мышьяком, марганцем, ураном и другими ядовитыми элементами в Западном Бангладеш. ... Для более чем 60 000 000 жителей Бангладеш питьевая вода представляет опасность, так как содержит большие концентрации загрязняющих веществ. ... Исследованы источники питьевой воды в различных регионах западного Бангладеш на содержание мышьяка, бора, бария, хрома, урана и др. химических элементов. ...

Еще в разделе: (Показать все результаты (>10) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=2&subtheme=11&from=0&ref_ind=0303100557

. Numerical methods of research on heat and mass intensification processes in power units. Book “Numerical simulation of vertical intensification of heat transfer in tube packages” . Numerical simulation results of heat transfer intensification on “eddy generating” surfaces with different turbulence models application. Heat and hydrodynamic pattern at flowing over the cylinder with “eddy generating” elements

Еще в разделе: (Показать все результаты (>11) - termogaz.imec.msu.ru/ )

• por_vduv_e
• scientific results_e

About SPAW Editor . ... As of final version 1.0 of the control you'll need to rename the file spaw_control.default.config.php in config sub-directory to spaw_control.config.php when installing control for the first time. ... All of the SPAW Editor configuration options are located in the config/spaw_control.config.php file. ... This file will be included in img_library.php (Image library dialog script). $request_uri variable will be set to the URL of the page where SPAW Editor instance resides. ...

Еще в разделе: (Показать все результаты (>2) - textbook.sinp.msu.ru/ )

... Department of Mathematics, . Faculty of Physics, MSU . ... Differential equations . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . Numerical methods in physics . ... Abstract differential equations with applications in mathematical physics . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Methods of finite differences in mathematical physics . ... April 13, 2016. ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>9) - math.phys.msu.ru/ )

Setting Up a Pay System Canada Business Service Centres - CBSCs Last Verified: 2004-05-28 Document No. 4046 Summary Pay administration is a management tool that enables you to control personnel cost, increase employee morale, and reduce work force turnover. ... This publication provides time-tested concepts for determining competitive pay levels and for maintaining fair pay relationships among the jobs comprising a small company. ... appraise employee performance under the plan. ... job title; . ...

Еще в разделе: (Показать все результаты (>51) - innovation.msu.ru/ )

• Start-Up Company Development :: Управление инновационной политики и организации

... Разработка и внедрение образовательных программ повышения квалификации специалистов в области инновационной деятельности . ... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 06/04/2016 . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... 27 марта 2016 года Московский государственный университет имени М.В.Ломоносова приглашает на весенний ДЕНЬ ОТКРЫТЫХ ДВЕРЕЙ . ... New technologies in gas chemistry . ...

Еще в разделе: (Показать все результаты (>5) - www.hsib.msu.ru/ )

• Master Degree in Geology | Высшая школа инновационного бизнеса МГУ

Метод конечных элементов. ... Основная концепция метода конечных элементов. ... Методы невязок. Метод Галеркина. ... Обзор подходов. ... Метод спектральных элементов (МСЭ). ... М.: Наука, 1994. 560 с. 2) Марчук Г.И., Агошков В.И. Введение в проекционно-сеточные методы. ... The finite element method. ... Solid mechanics, 2000. 479p. 6) D. Komatitsch and Jeroen Tromp Introduction to the spectral element method for three-dimensional seismic wave propagation. Geophysics, 1999, 139, 806-822. ...

Еще в разделе: (Показать все результаты (>5) - compmech.math.msu.su/ )

• http://compmech.math.msu.su/publ/publ_mensh.pdf

... Biological Faculty . Moscow State Lomonosov University . ... EDUCATION : B.S. Lomonosov Moscow State University, 1971 Physics . M.S. Lomonosov Moscow State University, 1972 Biophysics . Ph.D. Lomonosov Moscow State University, 1978 Biophysics . ... Lomonosov Moscow State University, 1990 Biophysics . ... 1972-1978 Research assistant Lomonosov State University, Moscow . ... Mathematical modelling in biology, . ... Lecturer at Biological Faculty, Lomonosov State University, Moscow . ...

Еще в разделе: (Показать все результаты (>3) - biophys.msu.ru/ )

... International Relations in Context of Global Processes - 17| ... GLOBAL ECONOMIC AND POLITICAL TRENDS Prof. Olga Y. Kornienko Economic literature survey Week 1 (4 academic hours ) 1) Current trends of global economy Week 2 (4 academic hours ) 2) Migration, population and globalization Week 3 (4 academic hours ) 3) Corporate culture and management: new trends Week 4 (4 academic hours ) 4) Development markets in global environment Week 5 (4 academic ... Models of the global world. ...

Еще в разделе: (Показать все результаты (>1560) - fgp.msu.ru/ )

... Nonlinear optics of ionized mediums . Fiber lasers . ... Emergence of powerful laser systems, being able to deliver powerful ultrashort light pulses, allows one to investigate and exploit new class of nonlinear-optical phenomena, based on the media ionization, when the electrons are released by strong electromagnetic field directly or by collision of an atom with another electron accelerated in the field. ... Ultrafast optical switching of an ionized medium by interfering ultrashort laser pulses. ...

Еще в разделе: (Показать все результаты (>6) - photonicslab.phys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• Align tool for DNA-protein complexes

... The Semantic Dictionary RUSLAN-1, the last version being Russian-to-English direction, is a tool for semantic and informational analysis of any coherent Russian text. The rich semantic information contained in the dictionary makes possible local, within one phrase, semantic interpretation as well as semantic analysis of coherent texts. ... Text understanding is very closely related to information analysis (Leontyeva 2000). ... We therefore call it "relative understanding". ...

Еще в разделе: (Показать все результаты (>4) - leontyeva.srcc.msu.ru/ )

• Semantic Resources for Textual Content Compression

... It carries out the basic communication op erations, such as b oundary exchanges and transp ositions of decomp osed data. ... Data distribution b efore transp osition. б б бвб бв б б б бвбв б бв б бвбв б б б б б бвбв б бв б бвбв б б бвб бв б б б бвбв б б бвбв б б б б б бвбв б бв б бвбв б б бвб бв б б б бвб бв б б б бвб бв б б б бвб бв б б б б бвбв б бв бвбв б бв бвбв б бв бвбв б бв бвбв б бв б бвбв б б бвб бв б б б бвб бв б б б бвб бв б б б ...

Еще в разделе: (Показать все результаты (>7) - geophys.srcc.msu.ru/ )