... Abstract A Uniform Resource Identifier (URI) is a compact string of characters for identifying an abstract or physical resource. ... This document defines a grammar that is a superset of all valid URI, such that an implementation can parse the common components of a URI reference without knowing the scheme-specific requirements of every possible identifier type. ... URI-reference = [ absoluteURI | ... Otherwise, the reference URI's scheme is inherited from the base URI's scheme component. ...

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1945.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1808.txt

Dynamo Theory and Earth's Magnetic Field Paul Demorest May 21, 2001 1 Intro duction The Earth's magnetic field belongs in that class of physical phenomena which are commonplace yet also very complex. ... 3 Single Disc Dynamo Before we dive into the mess of equations and approximations that describe how fluid motion and magnetic field interact, it is useful to demonstrate a very simple system which exhibits dynamo action. ... A system without fluid motion cannot support a magnetic field indefinitely. ...

Еще в разделе: (Показать все результаты (>17) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/courses/stathyd/2001%20Ferrari%20et%20al.%2C%20The%20temperature-salinity%20relationship%20of%20the%20mixed%20layer.pdf

... Working channel dimensions: length - 1200 mm, width - 300 mm, height - 30 mm; 50mm. Air velocity range in a working channel: 5-120 m/s with a step 0,1 m/s. Mass air rate: 0,2-1,3 kg/s . ... Model/flow temperature difference: up to 120C . ... Aerodynamic unit 'SAU-Siemens' was created to investigate heat exchange intensification on the surfaces with complex relief (dimples, grooves, etc) in flat channels at subsonic flow of working medium (air). ...

Еще в разделе: (Показать все результаты (>8) - termogaz.imec.msu.ru/ )

• aboutLab
• Numeric_e

... Форумы > Обсуждение сайта > Тема . Автор темы Алексей Ремизов . Форумы Список тем Новая тема . ... почта не работает! ... Вчера посылал вам письма по адресу administrator@mmonline.ru, . но у вас почта не работает! ... This message was created automatically by mail delivery software. A message that you sent could not be delivered to one or more of its . ... Ответить Цитировать . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>215) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура
• MMOnline | Форумы | Первокурсникам
• MMOnline | Форумы | Разное

Welcome to Fourmilab 's calendar converter! ... In the Julian calendar every fourth year is a leap year in which February has 29, not 28 days, but in the Gregorian, years divisible by 100 are not leap years unless they are also divisible by 400. ... The average length of a year is 365.2468 days compared to the actual solar tropical year (time from equinox to equinox) of 365.24219 days, so the calendar accumulates one day of error with respect to the solar year every 216 years. ... Excel serial day: . ...

Еще в разделе: (Показать все результаты (>13) - sbmg.geol.msu.ru/ )

Given word length and max number of mismatches . Use MEME algorithm for define conserved blocks . Apply the Dynamic programming algorithm to create chain of the blocks . Refine the chain using combined profile for chain of blocks. ... Reduce word length and number of mismatches and repeat the procedure for spacer between the blocks. ... Create helix profile and apply MEME-like iterative procedure to find sets of helices that consistent lokated reative to conserved blocks . ...

Еще в разделе: (Показать все результаты (>138) - bioinf.fbb.msu.ru/ )

• SDPpred
• SDPsite - Algorithm Format requirements

... Commission Members . Meetings . ... Commission on Paleopedology . ... Paleopedology Symposia during the XVII INQUA Congress, Cairns , Australia , 28 July - 3 August 2007 (full list of Symposia of INQUA Commission on Terrestrial Processes, Deposits and History (INQUA TERPRO) is available at the Congress web site ). ... Conveners: Daniela Sauer ( Germany ), Edoardo Costantini ( Italy ) Pedogenic analysis of aeolian deposits : Conveners: Martin Iriondo ( Argentina ), Birgit Terhorst ( Germany ) . ...

Еще в разделе: (Показать все результаты (>3) - www.paleopedology.msu.ru/ )

... The linguistic aspects of the model and the properties of the semantic dictionary ensuring the content analysis with compression of the text structure are considered. Our dictionary resources serve an instru- ment for building a multilevel textual semantic structure. ... Reason (A,B), where SemF(A) = SIT or a whole semantic formula; the same for SemF(B). ... Sem(SIT)R . ... Semantic Resources for Textual Content Compression // Fourth International Conference on Meaning-Text Theory (MTT'09). ...

Еще в разделе: (Показать все результаты (>4) - leontyeva.srcc.msu.ru/ )

• Lexical Resources for Personal Data Recognition in Texts

... about ERC . education . research . ... Statutes of ERC . ... MSU Nanotechnology Education and Research Center (ERC) was established to consolidate and coordinate efforts of MSU units aimed at research and development and education in nanotechnology and nanosystems. ... ERC activities conform to the current legislation, regulatory documents of the Ministry of Education and Science of the Russian Federation and the Federal Agency for Education, the Charter of MSU, and these Statutes. ...

Еще в разделе: (Показать все результаты (>25) - nano.msu.ru/ )

• Events | MSU Nanotechnology Education and Research Center
• Dye-sensitized Solar Cells ? Materials and Interfaces | MSU Nanotechnology
• International School ?Computer simulation of advanced materials?, 16?21 July

... International Relations in Context of Global Processes - 17| ... GLOBAL ECONOMIC AND POLITICAL TRENDS Prof. Olga Y. Kornienko Economic literature survey Week 1 (4 academic hours ) 1) Current trends of global economy Week 2 (4 academic hours ) 2) Migration, population and globalization Week 3 (4 academic hours ) 3) Corporate culture and management: new trends Week 4 (4 academic hours ) 4) Development markets in global environment Week 5 (4 academic ... Models of the global world. ...

Еще в разделе: (Показать все результаты (>1588) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-2.pdf
• Search Results пєп?п? п?п?пе п?п?. п?.п?. п?пЎп?пЎпҐпЎя?пЎп?п°
• п?п?пЇя?п?я?я?п°я?я? п©пЎп?я?п?п° пєп?п? п?п?пе п?п?. п?.п?.

... V.A. Khokhlova, A.E. Ponomarev; M.A. Averkiou; and L.A. Crum. ... Cavitation control by dual frequency high intensity focused ultrasound. 16th International Symposium on Nonlinear Acoustics (Moscow, Russia, 19-23 August 2002), p. 127. ... V.A. Khokhlova, M.A. Averkiou, A.E. Ponomaryov, L.A. Crum Generation of nonlinear signals by rectangular ultrasound sources in biological media. 16th International Symposium on Nonlinear Acoustics (Moscow, Russia, 19-23 August 2002), p. 26. ...

Еще в разделе: (Показать все результаты (>53) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/shanin_files/~shanin/papers/valyaev10.pdf

Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...

Еще в разделе: (Показать все результаты (>9) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~bahmurov/course_advanced_networks/ITU_OTN_Tutorial.pdf

General Information . ... The conference is organized by the Sternberg Astronomical Institute (SAI) of Moscow University and the IAU Working group "Site-testing Instruments" . ... Use of site data in telescope operation and adaptive optics. ... Recent conferences on this subject (2007, 2008) demonstrated great interest of the community, hence the need for a new meeting. ... Unlike previous recent conferences, this meeting will cover all aspects of site monitoring for optical/IR astronomy. ...

Еще в разделе: (Показать все результаты (>26) - site2010.sai.msu.ru/ )

Lomonosov project . News . ... Mikhail Lomonosov . Scientific goals . ... UFFO . ... October 9, 2011 . The ?Lomonosov? project was presented at the Russian Science Festeval. ... The connecting operation between the scientific equipment of the Lomonosov project and scientific telemetric system was started at joint stock company ?Russian Space Systems?. ... The flying model of UFFO device has arrived. ... The ?Lomonosov? project was presented at the international aerospace show MAKS 2011. ...

Еще в разделе: (Показать все результаты (>51) - lomonosov.sinp.msu.ru/ )

• Lost Password | Университетский спутник "Ломоносов"
• ELFIN-L | Университетский спутник "Ломоносов"
• Mikhail Lomonosov ? the Pioneer of Russian Science | Университетский спутник

4 SPIN. ... 0 1 Hello, world! ( ) ";" , active proctype main() { printf("Hello, world!\n") } ґ , >spin hello.pml Hello, world! 1 process created Hello, world! ... mtype = { P, C }; mtype turn = P; active proctype producer() { do :: ( turn == P) - printf( Produce\n ); turn = C od } active proctype consumer() { do :: ( turn == C) - printf( Consume\n ); turn = P od } ( 1) ґ 0, (op on sequence) (guard) ґ mtype = { P, C }; mtype turn = P; active proctype producer() { do :: ( ...

Еще в разделе: (Показать все результаты (>4) - savenkov.lvk.cs.msu.su/ )

• http://savenkov.lvk.cs.msu.su/mc/lect02.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>20) - mouse.genebee.msu.ru/ )

... Chair of Computer Methods of Physics . Department of Physics, M.V. Lomonosov Moscow State University . Create new account . ... Request new password . Username * . Enter your Chair of Computer Methods of Physics username. Password * . Enter the password that accompanies your username. ... Department of Physics M.V. Lomonosov Moscow State University , Chair of Computer Methods of Physics , 2014 . ... Let us know ! ...

Еще в разделе: (Показать все результаты (>3) - cmp.phys.msu.ru/ )

. Russian Version . Faculty of Computational Mathematics and Cybernetics . The Department of Operations Research . About Us . News . ORM2016: actual announcement and abstract templates . Archive of . Conferences ORM . Study . Undergraduates . Postgraduate education . Bachelor Program . Master Program . Faculty . Lecture . notes . Contacts . Graduates . New . publications . Create Date : 23.05.05 . The Department of Operations Research

Еще в разделе: (Показать все результаты (>24) - io.cmc.msu.ru/ )

• Кафедра Исследования Операций

... The Department of Operations Research . April 9, 2016 . Welcome Traditional topics of the conference Important dates Abstracts Registration . Final program Accommodation Program committee Organizing committee . ... V Moscow International Conference . on Operations Research, . ... Moscow, April 10-14, 2007 Final program . ...

Еще в разделе: (Показать все результаты (>11) - io.cs.msu.ru/ )

... Nonlinear spectroscopy . Nonlinear fiber optics . Attosecond optics . ... qqqqqqqqqqqq Rapidly progressing fiber-optic technologies open new avenues in biophotonics, providing an advanced platform for the creation of novel fiber-based imaging systems optical endoscopes, biophotonics-oriented fiber laser sources and optical neural interfaces. ... Как правило более точные методы регистрации ионных токов (с помощью электродов) сильнее ограничены по числу одновременно регистрируемых нейронов. ...

Еще в разделе: (Показать все результаты (>9) - photonicslab.phys.msu.ru/ )

• Aleksei Zheltikov
• Nonlinear optics of ionized mediums