... 000, 112 (2009) Printed 11 February 2010 A (MN L TEX style file v2.2) Analytical approximations of K -corrections in optical and near-infrared bands I1gor V. Chilingarian1 2 ,2,3 , Anne-Laure Melchior 1,4 and Ivan Yu. ... Received 2010 February 01; in original form 2009 August 14 ABSTRACT To compare photometric properties of galaxies at different redshifts, the fluxes need to be corrected for the changes of effective rest-frame wavelengths of filter bandpasses, called K -corrections. ... Table 1. ...
... Assume that gas is a thermodynamic system in the state of local equilibrium, that is, it is satisfied the relation [2] [pic] (1) There [pic],[pic] and [pic] are the temperature, the pressure and the gas volume, [pic], [pic] are entropy and internal energy per unit volume. ... Let us consider the first-degree form [pic]. ... Since the evolutionary relation is not identical, from this relation one cannot get the state differential [pic] that may point to the equilibrium state of the material system. ...
Cell Motility and the Cytoskeleton 63:2940 (2006) Regulation of Microtubule Dynamics in 3T3 Fibroblasts by Rho Family GTPases Ilya Grigoriev,1* Gary Borisy,2 and Ivan Vorobjev 1 1,3 Cell Biology and Histology Department, Moscow State University Biological Faculty, Vorobjevi Gory, Moscow 119992, Russia 2 Cell and Molecular Biology Department, Northwestern University Medical School, Chicago, Illinois 60611 3 ... Activation of RhoA in serum-starved cells stabilized the minus ends (Figs. ...
[
Текст
]
Ссылки http://cellmotility.genebee.msu.ru/html/articles/Grigoriev_2006a_CMC.pdf -- 434.6 Кб -- 04.02.2008 Похожие документы
. NON-STATIONARY OPERATION OF THE FAST-FLOW LASERS . AND NEW POSSIBILITIES OF CONTROLLING THE LASER OUTPUT CHARACTERISTICS . A.V. Mushenkov, A.Yu.Loskutov, A.I.Odintsov, A.I.Fedoseev and V.F.Sharkov . Physics department of M.V.Lomonosov Moscow State University, 119899, Vorob'evy gory, Moscow, Russia . Abstract . The dynamics of the lasing of the fast crossflow gas laser with the inhomogeneous steady state pumping in the unstable resonator by means of numerical modeling is investigated. Depending on the
ISSN 0026-2617, Microbiology, 2008, Vol. ... Key words: late stationary phase, secondary growth, Pseudomonas aeruginosa, S and M dissociants, population structure of the culture. ... Growth dynamics and population composition of a mixed culture of P. aeruginosa S and M dissociants in the variant of autolysis in the late stationary phase: optical density, OD з 100 (1); ratio of the M dissociant in the population, % (2); pH (3); and content of reducing sugars, mg % (as glucose) (4). ...
... Библиотека / The Somoninge of Everyman . ... GOD . ... EVERYMAN . ... FELAWSHIP . ... GOODES . ... GOOD DEDES . ... In my glory sholde make his mansion, . ... Where arte thou, Deth, thou mighty messengere? ... Hast thou thy Maker forgete? ... Thy many badde dedes, and good but a fewe, . ... And yet, if thou wilte ete, and drinke, and make good chere, . ... Good Dedes, I praye you helpe me in this nede, . ... Helpe my Good Dedes for my piteous exclamacion! . ... The Good Dedes shall make all sure. ...
30.12.2006 EN Official Journal of the European Union L 400/243 COUNCIL DECISION of 19 December 2006 concerning the specific programme : Ideas implementing the Seventh Framework Programme of the European Community for research , technological development and demonstration activities (2007 to 2013) (Text with EEA relevance) (2006/972/EC) THE COUNCIL OF THE EUROPEAN UNION , Having regard to the Treaty establishing the ... Article 3 1. ...
... UHECR SINP MSU . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... According to existing estimations it can be a prominent source of ultra high energy cosmic rays (UHECR). ... In either case, the newly born magnetar is an attractive site for producing ultrahigh-energy cosmic rays (particles with individual energies exceeding 10 18 e V ; UHECRs). ... A new mechanism for the acceleration of ultra high energy cosmic rays (UHECR) is presented here. ...
... About hotel . ... Rooms and prices . ... 1600 rub./day . A cozy room with an area of ??15 sq.m. equipped with modern comfortable furniture, a TV, telephone and bathroom. ... with double bed) . ... A cozy room with an area of ??20 sq.m. equipped with a double bed with bedside tables, wardrobe, desk, TV, telephone and bathroom. ... A large room of 25 square meters with a large bed and bedside tables, coffee table and chair, wardrobe, desk, TV, telephone and bathroom with heated floor. ...
Department of Physics, Lomonosov Moscow State University . Laboratory "Сryoelectronics" . Laboratory of Cryoelectronics (LCE) was established in the beginning of 1988 on the base of scientific group of Prof. Konstantin K. Likharev originated in 70-th at Physics Department of Moscow State University. ... As it was circumstantially formed, two organizations equipped our laboratory: the Physical Department of MSU and the section of Microelectronics of SIMP (NIIYaF) MSU. ...
Contemporary media environment is formed by dense concentration and interaction of cultures, languages, channels and modalities of communication. ... Across this new terrain, rich, exciting and risky, the new generation of media practitioners, teachers, researchers and public intellectuals is expected to navigate competently and creatively. ... Nor can the idea of intercultural communication be limited (as it was тАУ only recently) to relatively formal contact between established national cultures. ...
Open Conference Systems . Conference Help . ... Accommodation . ... Home > ICONO/LAT 2016 > 2014 International Conference on Laser Applications in Life Sciences . Following previous International Conferences on Laser Applications in Life Sciences (LALS), e.g. in Oulu, Taipei or Moscow, it is now our pleasure to invite you for LALS-2014 which will take place fromб June 29 th to July 2б nd in "Edwin Scharff Haus" conferences center at Ulm/Neu Ulm (Germany) on the banks of the Danube river. ...
Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Magnetospheric particles and radiation conditions . ... Scientific equipment . ... ELFIN-L . ... It consist of a Flux Gate Magnetometer (FGM), an Energetic Particle Detector for Electrons (EPDE), and an Energetic Proton Detector for Ions (EPDI). ... Energetic particles create a hazardous environment for satellites and humans in space and cause a number of satellite failures. ... Magnetospheric particles and radiation environment . ...
... education . research . ... Nanosystems and Nanodevices . ... Prof. Alexander Obraztsov in charge of the specialization. List of students . ... Opportunity to attend lectures of the best scientists of MSU faculties and get an interdisciplinary education. ... Opportunity to take part in projects of the Russian Corporation of Nanotechnologies (RUSNANO) and to get well-paid jobs after graduation. ... Приглашение на осеннюю школу-конференцию по Органической электронике 21?26 сентября 2014 года . ...
New photos are on my new site: photo777.org . ... photo . ... Pentax K20D . smc Pentax DA 18-55mm 3.5-5.6 II . smc PENTAX-FA 50mm F1.4 . Submitted by pyotr777 on Wed, 09/11/2011 - 15:01 . ... Hamburg photo gallery. June 3, 2010. ... Hamburg . ... Submitted by pyotr777 on Sun, 13/06/2010 - 18:06 . ... Submitted by pyotr777 on Sat, 12/06/2010 - 00:29 . ... May 29 - June 2, 2010. ... Submitted by pyotr777 on Tue, 08/06/2010 - 23:32 . ... Submitted by pyotr777 on Fri, 28/05/2010 - 10:40 . ...
... Квантовая теория . ... КВАНТОВАЯ ТЕОРИЯ ПОЛЯ [7-й-8-й семестры] (проф. СЛАВНОВ Д.А.) . ... СОВРЕМЕННЫЕ ТЕОРЕТИЧЕСКИЕ ПРОБЛЕМЫ ФИЗИКИ ВЫСОКИХ ЭНЕРГИЙ [10-й семестр] (с.н.с. САМОХИН А.П.) . ... проф. СЛАВНОВ Д.А. Квантовая теория поля описывает фундаментальные законы современной физики. ... Квантовая теория поля является теоретической основой физики высоких энергий и физики элементарных частиц. ... Квантовая теория поля и физика фундаментальных взаимодействий. ... Введение в квантовую теорию поля. ...
Serge Moscovici . Social Representations mailing list 1 postings, 28 Apr - 27 May 1997 . ... Deriabin wonders why social constructionism and social representations do not get close to one another. ... I cannot see where and how the theory of social representations has been rewritten to fit the cognitive paradigm. ... What is important for me now, at this point of my thinking, is the following: without a theory of social representations, we cannot understand social construction. ...
... Algorithm & . Format requirements . ... SDPsite is a tool for identification of protein active and other functional sites, based on spatial clustering of SDPs (specificity-determining positions, described here ) with CPs (conserved positions). ... Mapping predictied positions onto structure and construction of the best cluster . ... The input data of the algorithm are a multiple protein alignment divided into specificity groups . ... is called statistical significance of the set of k* positions . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы