... MSU Chamber Orchestra . ... Chamber Orchestra of Moscow State University was born in 1967. ... It was originally formed as a chamber orchestra at the School of Mathematics and Mechanics but soon (since September 1967) transformed into a Chamber Orchestra of the Moscow State University. ... The Chamber Orchestra of Moscow State University won the first prizes in the 1-st and 2-nd All-Union festivals of non-professional arts. ... Moscow State University does not have its own School of Music. ...
... О кафедре . ... КРИВОНОЖКО Владимир Егорович (11.06.1948, г. Москва) д.физ.-мат.н., профессор МФТИ, зав. кафедры АСУ МИСИС. ... Krivonozhko V. E., F rsund F. R. Lychev A. V. Terminal units in DEA: Definition and Determination // University of Oslo. ... F rsund F. R., Krivonozhko V. E., Lychev A. V. Hidden Effects in DEA Models //Differential Equations. ... Krivonozhko V. E., F rsund F. R., Lychev A. V. Some Ulterior Effects in the DEA models // Abstracts of the INFORMS Annual Meeting. ...
... About hotel . ... The hotel ?69th Parallel? is glad to present its renewed website which now has an option of online booking! ... Great stay! dns_support@antihotmail.com . ... Great hotel! ... best place in Murmansk that I've stayed! ... Stay was great. ... Always nice to have a good nights rest while enroute to my destinations. ... Very nice place . ... What a beautiful place, we enjoyed our stay! ... Best place ever! ... Next time we visit Murmansk we will definitely stay in this hotel. ... Good ....
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
CRIMEAN FIELD GEOLOGICAL CAMP, FIRST YEAR (1st CRIMEAN) . First Crimean Field Camp is organized for the MSU Geological Faculty first year students. ... Professors and researchers from Dynamic Geology Department of Geological Faculty and Russian Academy of Science Institute of Geology are leadind the students. ... SHORT HISTORY OF THE 1st CRIMEAN . ... The main goal of the field camp is to show students how geological processes work now and what we can learn about them in the past. ...
... Laboratory of Medicinal Chemistry was established at the Department of Chemistry, Lomonosov Moscow State University in October 2013. ... We apply modern molecular modeling and chemoinformatics methods as well as develop new approaches. ... We have developed efficient methods for the analysis of quantitative structure-activity relationships and design of novel promising structures based on diverse theoretical approaches. ... Home . ... Research . ... 2016 Laboratory of Medicinal Chemistry ...
... In 1964 at the Institute of Mechanics of Lomonosov Moscow State University the laboratory of physical-chemical gasdynamics had been set up under the supervision of Tirskiy G.A., which employed a team of three scientists - Tirskiy G.A., Gershbein E.A., Suslov O.N.; before they worked in the general hydromechanics division. ... V.N. Chelomey Medal of Astronautics Federation of Merit for the National Astronautics (2004, Kovalev V.L., Sakharov V.I., Tirskiy G.A.). ...
Gamma-rays above 10 TeV Dieter Horns University Hamburg RXJ1713-3946 [HESS Coll. ... The indirect path to the accelerator sky Dieter Horns University Hamburg Is it a good deal? [astro-ph/0607109] Unveiling Cosmic Ray accelerators: Interstellar medium ( B-field + gas + photons) Accelerated Nuclei Meson production via inelastic scattering Gamma-rays , Neutrinos Cosmic rays Neutral particles (photons neutrinos) retain directional information: Accelerator sky Charged particles ( ...
... More Reports . ... Defence calls reflect levels of discomfort in the pallid gerbil ( Gerbillus perpallidus ) // Advances in Ethology. Contributions to the 5-th International Symposium on Physiology, Behaviour and Conservation of Wildlife. ... In contrast, winners never called. ... We assumed that a shortening of the distance between combatants reflected an increase of discomfort for the loser (caller), whereas an increased distance reflected decreased discomfort. ... Research * Student Reports . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cs.msu.su ) . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ...
e-mail: soc@socio.msu.ru, vid@socio.msu.ru ) .. , . e-mail: ecsoc05@mail.ru ) " ", , " ", 1990- ., , , " ", , -, 2012 . capitalism for their", legitimacy of property, main stages of development "capitalism for their", economic impact of privatization 1990s, major projects legitimize property in Russia, compensating tax, "new social contract", offshore, networks in the Russian business elite, new privatization in 2012 , XXI ., ...
[
Текст
]
Ссылки http://www.socio.msu.ru/vestnik/archive/2013/3/04.pdf -- 217.5 Кб -- 27.11.2013
[
Текст
]
Ссылки http://vestnik.socio.msu.ru/archive/2013/3/04.pdf -- 217.5 Кб -- 12.01.2015 Похожие документы
МГУ имени М.В.Ломоносова Русская версия . ... About Conference . ... Asian and African Studies . ... Public and Municipal Administration . Public audit . ... Art Criticism and History . ... International Conference for Students and Young Scientists "Lomonosov" . ... 29 Feb 2016 . ... We invite to participation in the conference and in our scientific community everybody who is interested in current issues of government control (audit). ... Public audit: the issues of public finance . ...
Differences between the CO and NO Properties for Stability of Alkali Metal Complexes Me(XO)n+, X = C or N ALEXANDER V. LARIN,1,2 DMITRII N. TRUBNIKOV, DANIEL P. VERCAUTEREN1 1 2 Institute for Studies in Interface ... Notre Dame de la Paix, Rue de Bruxelles 61, B-5000 Namur, Belgium 2 Laboratory of Molecular Beams, Department of Chemistry, Moscow State University, Vorob'evu Gory, Moscow, B-234, 119899, Russia Received 9 December 2001; accepted 12 December 2001 ABSTRACT: The influence ...
ISTITUTO NAZIONALE DI FISICA NUCLEARE Sezione di Genova INFN/TC-06/14 October 17, 2006 A FIBER OPTIC AIR BACKED MANDREL HYDROPHONE TO DETECT HIGH ENERGY HADRONIC SHOWERS IN THE WATER M.Anghinolfi1, A.Calvi3, A.Cotrufo3, M.Ivaldi1, O.Yershova2, F.Parodi1, D.Piombo1, A.Plotnikov2 and L.Repetto3 1) INFN-Sezione di ... UniversitЮ degli Studi di Genova, Dipartimento di Fisica Via Dodecaneso 33, I-16146 Genova, Italy Abstract We have studied the design of an air-backed ...
Международный учебно-научный лазерный центр МГУ им. М.В. Ломоносова . Главная . ... О МЛЦ МГУ . Наука . ... Публикации . ... Заявки до 25 октября 2015г. Семинар МЛЦ и кафедры . ... Главная Публикации . ... Абстракт: We study the mathematical structure of superoperators describing quantum measurements, including the entangling measurement -- the generalization of the standard quantum measurement that results in entanglement between the measurable system and apparatus. ... 2008 МЛЦ МГУ . ...