Disjoining pressure of an electrolyte film confined between semipermeable membranes Salim R. Maduar and Olga I. Vinogradova Citation: The Journal of Chemical Physics 141, 074902 (2014); doi: 10.1063/1.4892758 View online: http://dx.doi.org/10.1063/1.4892758 View Table of Contents: http://scitation.aip.org/content/aip/journal/jcp/141/7?ver=pdfcov Published by the AIP Publishing Articles you may be interested in Order of wetting transitions in electrolyte solutions J. Chem. ... Chem.- ... Phys. Commun. ...

Еще в разделе: (Показать все результаты (>59) - nanofluidics.phys.msu.ru/ )

• http://nanofluidics.phys.msu.ru/paper/jcp2012_1.pdf
• http://nanofluidics.phys.msu.ru/paper/vinogradova-lobaskin-2012.pdf
• http://nanofluidics.phys.msu.ru/paper/derjaguin.pdf

CURRICULUM VITAE Last name: Straupe Name: Stanislav Middle name: Sergeevich Date and place of birth: 12 January 1984, Moscow , Russia Business address: International Laser Center, M.V.Lomonosov Moscow State University , Moscow 119899, Russia, Fax: 7(495)9391104; Phone: 7(495)939-43-72 Home address: Sivcev Vragek, 15/25, ap.39, ... S. P. Kulik, G. A. Maslennikov, E.V. Moreva, S.S. Straupe, "Quantum tomography of the optical four level states", Proceedings of SPIE, 6181, 618101 (2006) 2 ...

Еще в разделе: (Показать все результаты (>61) - qi.phys.msu.ru/ )

• Sergei Kulik: CV
• Sergei Kulik: Scientific interest

... 8 February , 2014 SAI seminar (Ryde et al 2010) 5 Thermal emission from GRB jet progenitor observer photon jet Photosphere (=1) · · · · Photons are not produced at the photosphere We have to calculate radiative transfer We need to know where the photons are produced We construct the expression for effective optical depth in relativistic flow considering random walk process in relativistic flow SAI seminar 6 8 ... 8 February, 2014 SAI seminar 28 ...

Еще в разделе: (Показать все результаты (>12) - master.sai.msu.ru/ )

Human longevity at the cost of reproductive success: evidence from global data ц б F . ... Abstract A trade-off between reproduction and somatic maintenance and hence survival is fundamental to life-history theory. We investigated the relationship between female fecundity and longevity in Homo sapiens using data from 153 countries located all over the world. The raw correlation between life span and fecundity was highly signi®cant with a negative trend. ... 1998; Polis et al., ...

Еще в разделе: (Показать все результаты (>31) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2003_Envir_human_EER.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• StructAlign help

... Surface disturbance and deformat ion are shown in the same scale. Displac the free surface is much smoother as compared bottom deformations: init ial elevat ion has amplitude and spreads over a rather wide area. bottom theory, bottom ement of with the smaller F ­ velocity potential, H ­ depth, ­ vector of bottom deformation, 0 ­ initial elevation a . ... The init ial elevation assumed to be equal to the vertical bottom deformat ion (a); calculated with use of the Laplace smoothing algorithm (b). ...

Еще в разделе: (Показать все результаты (>14) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/science/nosov/EGU2010_pumping.pdf

Call Title: Call for proposals for ERC Starting Independent Researcher Grant Call identifier: ERC -2010-StG Date of publication: 30 July 2009 Electronic proposal submission deadlines1 (single submission of full proposal): 2 Panels ... (Brussels local time) Panels: SH1 ­ SH6 (Social Sciences Humanities), 9 December 2009, 17.00.00 (Brussels local time) Indicative budget : EUR 528 237 600 from 2010 budget3 N.B.: The ... Proposals may be evaluated remotely. ...

Еще в разделе: (Показать все результаты (>30) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/AdG_call_2010.pdf
• http://ideas.msu.ru/docs/CSA_guide_2008.pdf
• http://ideas.msu.ru/docs/Work_programme_2011.pdf

... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...

Еще в разделе: (Показать все результаты (>154) - www.pereplet.ru/ )

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Рег.: ... Сообщений: 18453 . ... Рейтинг: 11759 . ... Обсуждение этого сообщения (6) . ... Сообщений: 2064 . ... Рейтинг: 2117 . ... Сообщений: 6629 . ... Рейтинг: 8963 . ...

Еще в разделе: (Показать все результаты (>244) - www.snto-msu.net/ )

• Толкование Исаака Ньютона к книгам Даниила и Откровение (Апокалипсис) - Public
• Re: Новинки программного обеспечения - Public forum of MSU united student
• Вакансии в HSBC - Public forum of MSU united student networks

... О факультете . ... Master In Ecology . ... Master (MSc) . ... A Master will be able to successfully deal with conceptual issues and practical problems related to various subflields of ecology and environmental science. ... Enables the students to develop biopolicies to deal with ecological problems caused by environmental pollution, the disruption of the ecological matrix of an area, and biodiversity-endangering factors. ... Lectures . ... Д 501.001.20 - все защиты . ... Биологический факультет МГУ ...

Еще в разделе: (Показать все результаты (>11) - www.bio.msu.ru/ )

• Seminar "Neurotechnology/Нейротехнологии" ? Биологический факультет МГУ

яЛП . id #389 . QSAR Combinatorial Sciences [not defined] . Common information . Periodicy: . [no information] . Impact-Factor: . [no information] . ISSN: . 1611-0218 . In print: . since 2003-01-01 till today . Language: . en . Price: . subscription - $1248,single article - $1 . Classifier: . [no at all] . Comment: . formerly: Quantitative Structure-Activity Relationships . Published by . (4) . Wiley Interscience - roboUpdate . No homepage defined . No open resources defined . Close . Complain . Edit

Еще в разделе: (Показать все результаты (>200) - journals.genebee.msu.ru/ )

... 9, 139 ­ 140 (2009) / DOI 10.1002/pamm.200910044 New cases of integrability in dynamics of a rigid body with the cone form of its shape interacting with a medium Maxim V. Shamolin 1 1 Institute Of Mechanics, Lomonosov Moscow State University, Michurinskii pr., ... We use the properties of body's motion in a medium under conditions of the jet flow past this body. ... The new families of phase portraits of variable dissipation systems are obtained, their absolute or relative roughness is demonstrated....

Еще в разделе: (Показать все результаты (>19) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-164-1.pdf
• http://shamolin2.imec.msu.ru/art-104-1.pdf

Summary Progress Report 2010 ­ 2014 UNESCO Chair on Global Problems and Emerging Social and Ethical Challenges for Large Cities and Their Population at the Faculty of Global Processes of the Lomonosov Moscow State University Period of activity: September 2010 June 2014 Title of the Chair : UNESCO Chair on Global Problems and Emerging Social and Ethical ... Visit of UNESCO Director-General Irina Bokova at Moscow State University September 9, 2011. ...

Еще в разделе: (Показать все результаты (>1541) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-2.pdf
• Search Results п¤п“пџ пњп“пе пёпј. пњ.п’. п›пѕпјпѕпЅпѕяЃпѕпІп°

ISSN 1560-3547, Regular and Chaotic Dynamics, 2015, Vol. ... 6 2015 SEQUENTIAL DYNAMICS IN THE MOTIF OF EXCITATORY COUPLED ELEMENTS 703 Then the system under study equation): 1 = = 2 3 = takes the following form (we deleted two multipliers from every (F (2 )+ F (3 ))1 (-1+2F (3 ) - 1 2 ), (F (3 )+ F (1 ))2 (-1+2F (1 ) - 2 2 ), (F (1 )+ F (2 ))3 (-1+2F (2 ) - 3 2 ). ... Vol. ... 6 2015 SEQUENTIAL DYNAMICS IN THE MOTIF OF EXCITATORY COUPLED ELEMENTS 709 function, the system takes the form (4.2). ...

Еще в разделе: (Показать все результаты (>84) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/704/186-the-self-propulsion-of-a-body-with-moving-internal-masses-in-a-viscous-fluid_ru.pdf

Oxana V. Dzhosan oxanad@mail.ru Scientific Data Visualization System for HighPerformance Computing MSU_VIZ Visualization system MSU_VIZ for Blue Gene /P Blue Gene /P MSU_VIZ Blue Gene /P front-end MSU_VIZ PC workstation Display MSU_VIZ 2D display - Data calculation - Video rendering - Video enhancement - Video compression - Video resizing - Display ... It is used for stereoscopic displays. ...

Еще в разделе: (Показать все результаты (>7) - angel.cs.msu.su/ )

• Appendix B File Format Specification

. КОМПЬЮТЕРЫ . Решение астрономической задачи N тел на кластере из ГПУ (pdf) . Exploring weak scalability for FEM calculations on a GPU-enhanced cluster (pdf) . Using GPUs to Improve Multigrid Solver Performance on a Cluster (pdf) . ClawHMMER: A Streaming HMMer-Search Implementation (pdf) . Проект Folding@Home . Лаборатория Параллельных информационных технологий НИВЦ МГУ .

197. Galeev Elfat Mikhailovich | Department: General Problems of Control. Faculty of

198. NPIDB: Interaction

199. БЧА НИВЦ МГУ. SF51R_C. Специальные функции математической статистики

200. http://theorphys.phys.msu.ru/education/aqft_slides/ExamSyllabus_Term1.pdf