... Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mechmath faculty admission resumed its work and is actively preparing for the new reception 2015! ... Read more about Schedule in June . ... The Dean of Mechanics and Mathematics Faculty, the head of the Department of Mathematical and Computer Analysis Methods, professor Vladimir Chubarikov ; . ... Read more about The Open Day . ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>4) - pk.math.msu.ru/ )

• About Mathematics and Mechanics Faculty | Mechmath admission for internetional
• IX Festival of Science | Mechmath admission for internetional students
• information | Mechmath admission for internetional students

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

M obile A stronomical Sy stem of TE lescope- R obots MASTER-II Kislovodsk Lomonosov Moscow State University, Sternberg Astronomical Institute , Moscow Union "Optic" , Kislovodsk Solar Station Latitude = 43 o љ44'.767љN; Longitude = 42 o љ31'.417љE; Altitude = 2067љm MASTERљIIљ(8љsquareљdegress) + MASTERљVWF(VeryљWideљFieldљCameras (FOV=800 square degrees, Timeљresolutionљupљtoљ150љms, with unfiltered m_lim=14m on 5 sec. exposure, and ~10.5m with 0.15 sec) . ... 11h 38m 38.0s , -09d 59m 59s) . ...

Еще в разделе: (Показать все результаты (>2) - apollo.sai.msu.ru/ )

• Meteo :: Kislovodsk Database ::

Welcome to Fourmilab 's calendar converter! ... In the Julian calendar every fourth year is a leap year in which February has 29, not 28 days, but in the Gregorian, years divisible by 100 are not leap years unless they are also divisible by 400. ... The average length of a year is 365.2468 days compared to the actual solar tropical year (time from equinox to equinox) of 365.24219 days, so the calendar accumulates one day of error with respect to the solar year every 216 years. ... Excel serial day: . ...

Еще в разделе: (Показать все результаты (>16) - sbmg.geol.msu.ru/ )

• Europrobe Moscow Workshop, October 29, 2001, Vernadsky museum
• INTAS team Workshop, October 28, 2001, Moscow university
• Ф-502

Заведующий кафедрой Head of the Chair . ... История кафедры . ... В 1966 г. для расширения ведущихся на кафедре научных работ в НИИ Ядерной физики МГУ был создан отдел физики плазмы (ОФП), в 1989 году переименованный в отдел микроэлектроники (ОМЭ). ... Сегодня по различным научным направлениям, ведущимся по специальностям, преподаваемым на кафедре атомной физики, физики плазмы и микроэлектроники, работает около 100 научных сотрудников, среди которых 12 докторов наук и около 50 кандидатов наук. ...

Еще в разделе: (Показать все результаты (>2) - www.affp.mics.msu.su/ )

... Search for Single Top Quark Production at DZero using Neural Networks" . ... Search for Single Top Quark Production at D0 Using Neural Networks" . ... Search for Electroweak Production of Single Top Quarks" . ... Use of Neural Networks in a Search for Single Top Quark Production at D0", . ... Search for Single Top Quark Production at the Tevatron" . ... Use of Neural Networks in a Search for Single Top Quark Production with the DZero Detector at the Fermilab Tevatron Collider", . ...

Еще в разделе: (Показать все результаты (>10) - top.sinp.msu.ru/ )

• Lev V. Dudko Home Page

... В данном разделе приводятся публикации проекта по созданию семейства реконфигурируемых вычислительных систем в рамках государственного контракта N 02.524.12.4002 от 20 апреля 2007 г. федеральной целевой программы "Исследования и разработки по приоритетным направлениям развития научно-технологического комплекса России на 2007-2012 годы". ... Материалы Международной научной конференции "Параллельные вычислительные технологии" (ПаВТ 2008), г. Санкт-Петербург, 29 - 31 января 2008, Россия. ... Минск,...

Еще в разделе: (Показать все результаты (>3) - fpga.parallel.ru/ )

People . ... N. A. Brazhe . ... The Cell biophysics group unites a number of laboratories at the Biophysics Department of the Biological Faculty, Moscow State University, Russia. We aim at a deeper understanding of cellular and intercelullar processes. The use of a wide spectrum of experimetnal techniques as well as an advanced data series analysis helps us in our quest for a better knowledge of cell biophysics. ...

Еще в разделе: (Показать все результаты (>6) - cell.biophys.msu.ru/ )

... Sov.Phys.-Plasma Phys.) 1978.V.4. ... Timofeev I.B., Bychkov V.L. Influence of ionizing processes on the lifetime of plasma ball in air. ... Bychkov V.L. Database on ball Lightning for PC. ... Bychkov V.L., Bychkov A.V., Stadnik S.A. Polymer Fire Balls in Discharge Plasma. ... Emelin S.E., Bychkov V.L., Astafiev A.M., Kovshik A.P., Pirozerski A.L. Role of discharge products throttling for generation of ball lightning with a condensed core from a high pressure vapor - gas phase Proc. 11-th Intern. ...

Еще в разделе: (Показать все результаты (>10) - physelec.phys.msu.ru/ )

• http://physelec.phys.msu.ru/staff/abdusame/publ.doc

Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...

Еще в разделе: (Показать все результаты (>2) - tepa2012.sinp.msu.ru/ )

... The surface mixed layer of the ocean is often characterized by density compensation between the horizontal temperature and salinity gradients. ... The coupling arises through a nonlinear diffusion operator proportional to the buoyancy gradient, which parameterizes the combined effect of slumping and mixing of small-scale horizontal buoyancy gradients. ... Mesoscale stirring will create small-scale temperature and salinity gradients by stretching and folding the large scale thermohaline patterns. ...

Еще в разделе: (Показать все результаты (>15) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/courses/geo/lectures-addons/15/2001%20Demorest%2C%20Dynamo%20theory%20and%20Earth's%20magnetic%20field%20.pdf
• http://ocean.phys.msu.ru/pubs/Chashechkin-Waves.pdf

... Инструкция по работе с информационными ресурсами в ОРОКС . ... Основные разделы сервера: Выбор раздела сервера ------------------------------------ На первую страницу "ChemNet" ------------------------------------ Химический факультет МГУ ------------------------------------ Электронная библиотека по химии ------------------------------------ Базы данных и другие источники информации по химии ------------------------------------ Периодические издания по химии -- Вестник МГУ. ...

194. Данные - Группа дистанционного зондирования атмосферы

195. admin | Онлайн-фестиваль дружбы

196. Belozersky institute, department of Electron Microscopy.

197. http://library.biophys.msu.ru/PDF/3329.pdf

198. staff:guterman:activ_rus.html | Кафедра высшей алгебры

199. SAI OCL Catalog Publications

200. http://storage.bioinf.fbb.msu.ru/~roman/mol_biol_mosk_2006.pdf