... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• ConClus

... Surface disturbance and deformat ion are shown in the same scale. Displac the free surface is much smoother as compared bottom deformations: init ial elevat ion has amplitude and spreads over a rather wide area. bottom theory, bottom ement of with the smaller F ­ velocity potential, H ­ depth, ­ vector of bottom deformation, 0 ­ initial elevation a . ... The init ial elevation assumed to be equal to the vertical bottom deformat ion (a); calculated with use of the Laplace smoothing algorithm (b). ...

Еще в разделе: (Показать все результаты (>49) - ocean.phys.msu.ru/ )

• Index of /courses/stathyd/
• Index of /courses/geo/lib/books/Brown x26; Mussett The Inaccessible Earth/
• Index of /courses/geo/lectures-addons/02/

... International Scientific Conference "Probability Theory and its Applications" on Occasion of the 85-th Birthday of Yu.V.Prokhorov љis organized by the Steklov Mathematical Institute andљFaculty of Computational Mathematics and Cybernetics of Moscow State University fromљ12 to 14 of February, 2015 and will take place at the Faculty of Computational Mathematics and Cybernetics of Moscow State University .љ ...

Еще в разделе: (Показать все результаты (>3) - smu.cmc.msu.ru/ )

... About Journal | ... The Editorial team's publication decisions are made based on the data reliability and the scientific value of the work despite the race, gender, nationality, citizenship, social position, religious or political views of the Authors. ... The Reviewer performs the impartial expertise of Author's materials. ... The Reviewer must notify the editorial team on any interest conflict with the Author, with the request for excluding him from the reviewing of the given manuscript. ...

Еще в разделе: (Показать все результаты (>50) - www.socio.msu.ru/ )

• English version - Социологический факультет МГУ

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ HYDROACOUSTIC ANTENNA : A POWERFUL TOOL TO FORECAST TSUNAMIGENIC EARTHQUAKES Yakov S. Karlik Central Research Institute MORPHYSPRIBOR , 46 Chkalovsky proezd, Sankt-Petersburg, 197378 Russia E-mail: karlik@mail.cl.spb.ru ABSTRACT Hydroacoustic antenna ... 2001). ... Eiby, J.A., 1982: Earthquakes. ...

Еще в разделе: (Показать все результаты (>26) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/Recommendations.pdf
• http://seac47-2.phys.msu.ru/proc/E22_Watts.pdf
• http://seac47-2.phys.msu.ru/proc/E03_Didenkulova_Peli.pdf

... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...

Еще в разделе: (Показать все результаты (>2) - www.ccl.msu.su/ )

... The applied mathematics (with Honors), Kazan State University, Kazan, Russia (USSR), 1980. nd Alexander Lazarev Research Interests Discrete optimization: combinatory problems, modeling, decomposition algorithms, applications to production planning and scheduling. ... Kazan, Publishing house of the Kazan mathematical society, 1998. - 285 p. Lazarev A.A., Gafarov E.R. Scheduling Theory. ... Computer centre of the Russian Academy of Sciences - 2006. - 134 p. Lazarev A.A., Gafarov E.R. Scheduling Theory...

Еще в разделе: (Показать все результаты (>6) - physcontrol.phys.msu.ru/ )

• Widgetkit

... pobedria@member.ams.org . ... Since that time he has read the following courses of lectures: Mechanics of Continuous Media, Numerical Methods, Classical Mechanics, Mechanics of Solids, Theory of Elasticity and Plasticity, Tensor Analysis, Theory of Viscoelasticity, Composites Mechanics, Stability of deformation processes, Mathematical theory of Shells, Dynamic problems of the Composites Mechanics. ... Member of the European Community on Computational Methods in Applied Sciences (ECCOMAS)(1996) . ...

Еще в разделе: (Показать все результаты (>4) - composite.msu.ru/ )

• INTAS 95-525 Final Reprort (Short version)
• Department of the Composites Mechanics

... President George W. Bush Department of Education Strategic Goals: Goal One: Create a Culture of Achievement Create a culture of achievement by effectively implementing the president's plan, No Child Left Behind, and by basing all federal education programs on its principles: accountability, flexibility, expanded parental options, and doing what works. ... Goal Six: Establish Management Excellence Create a culture of accountability throughout the Department of Education. ... accountability | ... line...

Еще в разделе: (Показать все результаты (>2) - www.edst.msu.ru/ )

... Program . ...

Еще в разделе: (Показать все результаты (>39) - pont2008.cmc.msu.ru/ )

Division of Experimental and Theoretical Physics . ... Theory of gauge fields and its applications to elementary particle physics . Unified theory of physical effects and phenomena in systems of particles with electromagnetic interaction . ... Methods of Lobachevsky geometry in non-linear problems of mathematical physics . ... Interaction of ultra-short laser pulses with matter, investigations of physical properties of new materials for quantum- and optoelectronic systems . ... Materials science . ...

Еще в разделе: (Показать все результаты (>39) - foroff.phys.msu.ru/ )

• Offered courses
• Postdoctoral training (General Physics and Wave Processes)
• Papers of our group

Search of Novel Crystalline Materials , Study of their Properties and Crystallization Processes . ... The work of group for the search of novel crystalline materials are held at M.V. Lomonosov Moscow State University since 1964. The main aim of investigations are search and study of new promising multifunctional materials with unusual physical properties: ferroelectrics, superionic conductors, nonlinear optical materials, laser crystals, piezoelectrics, etc. ...

Еще в разделе: (Показать все результаты (>5) - newcryst.phys.msu.ru/ )

• List of Publications Naumova

General Information . ... Invitations for all paticipants which have submitted this information will be sent by express mail to participants in mid-September (for european citizens a little earlier). With this invitation you will be able to apply for a visa. But maybe you will need hardcopy of invitation only in moment of obtaining of visa while application could be made with scan of invitation. ... Please note that usually it takes about 5-7 days to obtain a visa with official invitation. ...