... All rights reserved 0006-3509/96 $24.00+ .00 PH: 80006-3509(96)00171-8 TYPES OF NON-LINEAR BEHAVIOUR OF THE SYSTEM OF ION TRANSFER ACROSS THE MEMBRANE ON EXPOSURE TO A WEAK ELECTRIC FIELD* · 1 · T. Yu. ... L.- x Fig. ... Changes in the concentration of protons in response to external periodic perturbation external action A = 0.003 and critical frequency frequencies, periodic oscillations take place, x and potassium ions y in the near-membrane layer by a weak electric field. ...
Moscow State University Belozersky Institute of Physico-Chemical Biology . Department of Electron Microscopy is a sub-division of A.N. Belozersky Institute of Physico-Chemical Biology . ... We are interested of how eukaryotic cell is organized, formed and functioned. Since A.N. Belozersky Institute of Physico-Chemical Biology is one of the scientific departments of Moscow State University ? ... Understanding the metaphase chromosome architecture remains a basic challenge in cell biology. ...
JOURNAL OF STRUCTURAL BIOLOGY 113, 217-224 (1994) Centrosome Behavior under the Action of a Mitochondrial Uncoupler and the Effect of Disruption of Cytoskeleton Elements on the Uncoupler-lnduced ... 119899, Russia Received October 3, 1994, and in revised form February 6, 1995 Carbonyl cyanide p-(trifluoromethoxy)phenylhydrazone ( FCCP ) induced in pig kidney embryo cells a loss of rhodamine 123 staining of mitochondria in 2-3 min ... In 3 cells, the active centriole possessed three satellites. ...
[
Текст
]
Ссылки http://cellmotility.genebee.msu.ru/html/articles/alieva94.pdf -- 1568.2 Кб -- 20.05.2002 Похожие документы
... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...
Генетическая кристаллохимия . ... Исследуются причинно-следственные связи структурных преобразований в гомологических и морфотропных рядах минералов. ... На примере минеральных групп фосфатов, боратов, силикатов, ванадилфосфатов и борофосфатов прослеживаются пути формирования и преобразования кристаллических структур минералов в породах различных геохимических типов . ... Типоморфизм минералов. ... Якубович О.В., Урусов В.С. Генетическая кристаллохимия фосфатов гранитных пегматитов // Вестник МГУ. ...
О КАФЕДРЕ . ... Трухин В. И. Жиляева В.А. Жиляева А. И. Петрунин Г. И. Список публикаций ћСписок статей . ... Бобров А. В., Жиляева А. И. Минеральные ассоциации включений в гранатах из кимберлитовых трубок Мир и Сытыканская (Якутия) //Вестник НСО. ... A. Zhilyaeva, L. Leonyuk, G.-J. Babonas, G. Bocelli, S. Demishev, N. Leonyuk, V. Maltsev, A. Reza. ... Трухин В.И., Жиляева В.А., Жиляева А.И. Вязкая намагниченность (VRM) базальтов тройственного сочленения Буве (Южная Атлантика) // Физика Земли. ...
... О кафедре . ... О профессорах кафедры . ... Программы общих курсов . ... Квантовая теория . ... Курсовые работы для 2-го курса . ... Новости . ... Новости кафедры . ... В разделе Квантовая теория выложены список всех тем курса и вопросы к экзамену. ... Приказом Ректора МГУ профессор Виктор Иванович Денисов с 02.11.2015 г. назначен заведующим кафедрой квантовой теории и физики высоких энергий физического факультета МГУ. ... С 8 апреля пройдет тестирование студентов 3-го курса по квантовой теории. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
List of candidate helices . For each helix: plot of its probability vs. time . List of structures . For each structure: plot of its probability vs. time . ... Helix ID (a number used to identify the helix in structures) . ... Kinetic constant for helix decay . Plot of helix's probability vs. time . Helix probabilities . Summary plot of helix probabilities vs. time . ... Plot of structure's probability vs. time . ... Summary plot of structure's probabilities vs. time . ...
... David Kirk/NVIDIA and Wen-mei W. Hwu , 2007-2012 ECE408/CS483, University of Illinois , Urbana-Champaign 14 CUDA Device Memory Management API functions · cudaMalloc() Allocates object in the device global memory Two parameters · Address of a pointer to the allocated object · Size of of allocated object in terms of bytes ( Device ) Grid Block (0, 0) Block (0, 1) Registers Registers Registers Registers · cudaFree() Frees object from ...
[
Текст
]
Ссылки http://ccoe.msu.ru/sites/default/files/presentations/MSU-Lecture-CUDA-Intro-2012.pdf -- 1008.0 Кб -- 25.10.2012 Похожие документы
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...
... Department of Mathematics, . Faculty of Physics, MSU . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Extremal problems . ... Methods of finite differences in mathematical physics . ... 13 th Annual workshop will be organized by the of Department of Mathematics of Physics Faculty at Moscow State University , Moscow, Russia. ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...
... Using Ar clusters accelerated by 30 kV, with a dose of ° ° 6 · 1014 e cmю2, we have effectively removed an asperity that was 3500 A wide and 350 A high. Subsequent processing ° ° with 5 kV acceleration reduced the surface roughness from an Ra value of 13.2 A to 4.8 A. This demonstrates the effectiveness of GCIB for reducing sub-micron roughness to atom level smoothness. с 2005 Elsevier B.V. All rights reserved. ... Technique and results Fig. 1 shows schematically the GCIB beamline [2]. ... Fig. ...
[
Текст
]
Ссылки http://danp.sinp.msu.ru/Articles_GSIB/nimb_GCIB_Ar_Smoothing_Swenson.pdf -- 263.6 Кб -- 07.10.2005 Похожие документы
... НАШ ФАКУЛЬТЕТ . ... Учебный отдел . ... Комплексное социологическое исследование: ?Современная система высшего образования глазами студентов, аспирантов и профессорско-преподавательского состава МГУ имени М.В. Ломоносова? ... Представляем Вашему вниманию программу 24-й секции ?Социальные исследования и современность?, которую проводит Высшая школа современных социальных наук МГУ имени М.В. Ломоносова. ... Copyright 2016 Высшая школа современных социальных наук (факультет) МГУ имени М.В.Ломоносова. ...
... DOI љ] . ... Surface Science 606 , 3-4 (2012), 394?400. ... Soldatov, E., Kislov, V., Gubin, S., Artemyev, M., Kisiel, D., Sergeev-Cherenkov, A., Pavlov, S., Trifonov, A., and Khomutov, G. Monomolecular polymeric films with incorporated au-101 clusters.љ ... Surface Science 532 (2003), 287?293. ... Obydenov, A., Gubin, S., Khanin, V., Polyakov, S., Sergeyev-Cherenkov, A., Soldatov, E., Trifonov, A., and Khomutov, G. Structure and properties of langmuir-blodgett films containing cluster molecules.љ ...
... В.Е.Юрасова, Современные теории катодного распыления и микрорельеф распыляемой поверхности металла, ЖТФ, 1958, 28, ?9, 1966-1970. ... V.I.Shulga, I.G.Bunin, V.E.Yurasova, V.V.Andreev, B.M.Mamaev, Influence of surface semichannels on ion scattering by crystals, Phys. Lett., ... Рентгеновские, синхротронные и нейтронные исследования, 2000, ? ... Особенности распыления сплавов Ni-Pd с разным содержанием компонент, Поверхность - рентгеновские, синхротронные и нейтронные исследования, 2006, ?7, 13- 17. ...
... In vitro, the protein S7 of Thermus thermophilus is able to form complexes with both the minimal 16S rRNA fragment and the intercistronic region of the str operon mRNA from E.coli (Kd = 1.4x10-7 M and 1.1x10-7 M respectively). ... The filter binding assay. ... The most striking result of our study is that thermophilic protein S7 binds strongly to the E.coli S12-S7 intercistronic region of str mRNA in vitro, inspite of the lack of the functionally analogous thermophilic extended region. ...
[
Текст
]
Ссылки http://rnp-group.genebee.msu.su/pdfs/febsz.pdf -- 49.2 Кб -- 21.10.2002
[
Текст
]
Ссылки http://rnp-group.genebee.msu.ru/pages/pdf/febs1998.pdf -- 49.2 Кб -- 18.02.2008 Похожие документы
. Jump to: navigation , search . You must log in to view other pages. Retrieved from " http://algcourse.cs.msu.su/teachwiki/index.php/MediaWiki:General_disclaimer " . Message . Discussion . Log in . Новости, главное . Страница курса . Сдача заданий . 1-й семестр 2015 г. Материалы по системе ejudge . Планы прошлых лет . Участники . Recent changes . What links here . Special pages . Printable version . Privacy policy . About MediaWiki . Disclaimers