... CUDA Showcase - список приложений, использующих CUDA (на сайте NVidia). RapidMind Case Studies - примеры использования RapidMind для программирования ГПУ (и не только). AMD Stream Computing Blog - примеры использования вычислительной платформы AMD Stream Computing для программирования ГПУ от AMD. Core Image - компонент интерфейса программирования Mac OS X, использующий вычислительные мощности графического процессора для отрисовки эффектов пользовательского интерфейса. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...
... Department of Vertebrate Zoology . ... Vertebrate Zoology - for the 1-year students (prof. L.P.Korzoun) . Special Vertebrate Zoology - elective course for the 2-year students studying zoology and botany (associate prof. S.V.Ogurtsov ) . ... Zoogeography (leading researcher V.V.Inanitskii) . ... Seminar 'Actual Problems of Vertebrate Zoology' - for the 5th year students (leading researcher M.E.Goltsman, researcher O.A.Filatova) . History of Zoology (leading researcher V.S.Shishkin) . ...
звоните, мы в Москве(926)6667253 art-sale@mail.ru . Начало www.99ru.ru Виниловые пластинки Запад 15614 . ... Искусство . История.Философия . ... Художественные . ... История Всемирная . ... Искусство и культура . ... Другие виды искусства . ... Теория искусств.Эстетика . ... Этнография Фольклор . ... Наследие Востока . ... Фольклор . ... СССР (после 1917) . ... Введите код товара из каталога. автор Kraftwerk . ... Западных уже нет, остались кое-какие лицензионные СССР звоните, тел.сверху . ...
FNAL SELEX experiment. ... Моя Atlas страница здесь, в МГУ. ... Страница памяти Юрия Александровича Лазарева . ... Л.Д. Ландау ? ученый, учитель, человек?(.pdf) . ... Круг Ландау: Физика войны и мира?. 2009 г., 269 стр.) ... Л.Д. Ландау?(.pdf) . 32 стр.) ... Бонсай в Москве, декабрь 2015 г. Южная Индия в январе 2011 г. Петербург в ясном октябре 2010 г. Фото на станции метро Лубянка после теракта 29 марта 2010 г. (30 марта и 6 апреля). ... Фото Гелл-Манна , выступавшего в МГУ 25.09.2007. ...
Welcome to ASC14 To whom it may concern With the supports from the High Performance Computing (HPC) experts and organizations, the ASC13 Student Supercomputer Challenge has concluded with great success. ... We are calling for registration and preliminary contest preparation. ... Some of them may finally take HPC as a career option, such as some students from National Defense University team have already contributed to the Tianhe-1A and Tianhe2. ... Award Overall Gold Winner: 100K RMB (~16000 USD) . ...
[
Текст
]
Ссылки http://smu.cs.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cs.msu.su/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013
[
Текст
]
Ссылки http://smu.cmc.msu.ru/sites/default/files/attachments/ASC14%20Invitation%20Letter.pdf -- 1094.9 Кб -- 04.12.2013 Похожие документы
... Кафедры . ... Krasnoslobodtsev V. P. Territorial availability of higher education in the Northern Caucasus. ... The Northern Caucasus with its relatively favorable demographic structure of population as compared to the rest of Russia is experiencing the profound growth in the availability of higher education. ... In 2007 90% of population of the Northern Caucasus lived within daily distance from higher schools providing mass and prestigious higher education (in law and economics, for example). ...
... Science Park . ... Agency for networking, information and communication technologies ( NETINFOKOM LLC) ank-nic@rambler.ru http://www.msunews.ru/ . ... Developing the infrastructure and information support needed for projects that provide an interdisciplinary exchange of science information and the potential for collective work on the base of network services and technologies. ... The company has a great deal of experience in the design, development and penetration of laboratory information systems. ...
. ПО КУ . Ссылки . Статьи и тезисы . Интернет . Литература . CVS-репозитории . Утилиты . Доступ к информации . Linux SAL Parallel Computing Page . http://suparum.rz.uni-mannheim.de/docs/ind.html . Partial evaluation for MPI optimization . Berkeley Reserach Areas . IOZone filesystem benchmark . SEL-HPC Article Archive . $Date: 2000/10/12 01:09:52 $ . Home . Andrey Slepuhin .
About BAFIZ . BAFIZ at SINP MSU . Bafiz' Information Resources at SINP . ... Information Services . ... Space Physics Information Home Page . The Centre for Photonuclear Experiments Data (Centr Dannykh Fotoyadernykh Eksperimentov, CDFE)" . Data Services . Data Base of Low Altitude Space Radiation Environment (DB LASRE SINP MSU) . Space Physics Data Archives . Space Physics Data On-Line Services . ... This Page is developed at Laboratory of Computational Mathematics, . ...
Sergey Vladimirovich Petrushanko Afflilation and official address: Skobeltsyn Institute of Nuclear Physics , Lomonosov Moscow State University Leninskiye Gory, Moscow 119991, Russia E-mail: sergeant@mail.cern.ch Date and place of Birth: 24 March 1975, Sverdlovsk (USSR) Citizenship: Russian Federation Education: 2002 Ph.D. (High energy physics ) Skobeltsyn Institute of Nuclear Physics , Lomonosov Moscow ...
... In particular, Jmol.js uses the split version. ... To invoke JmolApplet.jar from Jmol.js, either: a) put it in the folder containing the HTML page requiring it and do not use jmolInitialize() or b) identify it explicitly in jmolInitialize(), for example: jmolInitialize("folder-containing-jar-files", "JmolApplet.jar") - JmolAppletSigned.jar An equivalent version of the applet, but this is a "signed" or "trusted" applet (a term in Java security language). ...
... В левой части открывшегося окна Group Policy найдите раздел Local Computer Policy | ... Windows Update . ... Дважды щелкните по строке Configure Automatic Updates , в открывшемся окне поставьте переключатель в положение Enabled. ... Задав настройки для параметра Configure Automatic Updates, щелкните Next Policy и в окне Specify intranet Microsoft update service location Properties поставьте переключатель в положение Enabled, а в обоих полях ввода текста обязательно введите http://wsus.chem.msu.ru . ...
Психология имеет долгое прошлое, но довольно короткую историю" (Г. Эббингауз, 1908) . Статьи и ссылки по истории психологии. Конференции 2000 года. ... Millennium World Conference in Critical Psychology, Sidney, Australia . XXVII Congress of Psychology 2000, Stockholm, Sweden . ... CSS 2000, the annual online conference for the Association for Computers and the Social Sciences . ... CiP2000, Computers in Psychology Conference , 29th March - 31st March 2000, University of York, UK. ...
... Миронов А. М. (Институт Программных Систем РАН) Математические модели и методы анализа параллельных алгоритмов. ... Изложены методы анализа параллельных алгоритмов в рамках представленной модели, являющиеся обобщением методов анализа блок-схем последовательных программ путем построения индуктивных утверждений. ... Math., 19; in: J.T.Schwartz (ed.), Mathematical Aspects of Computer Science, pp. ... N. Francez, "Verification of programs", Addison-Wesley Publishers Ltd., ...
... Probe flash (energy/duration) . ... 0.01 J / 0.01 ms . ... Submersible unit (dimension/weight) . Power supply unit (dimensions/weight) . ... 300 x 300 x 50 mm / 1 kg . ... Power supply . ... The complete set of PrimProd fluorometer consists of the following mainframes: submersible probe, 12 DC on-board block power supply, IBM-compatible computer, connecting cables and cable-rope. ... Submersible probe. ... On-board power block provides the necessary voltage (42 V) supply at the submersible probe. ...
... Introduction to the contemporary phylogenetics ( a cladogenetic aspect). ... The book contains a review of theoretical fundamentals, principles, notions, methods, and applications of the contemporary phylogenetics (with emphasis on its cladogenetic aspect). ... Principal algorithms and methods of numerical phyletics are briefly outlined, including numerical estimates of phylogenetic relationship and recent methods of constructing phylogenetic trees (compatibility, parsimony, maximum likelihood , etc...