Research paper Struct Multidisc Optim 27, 435 ­ 445 (2004) DOI 10.1007/s00158-004-0388-x Optimal shapes of parametrically excited beams A.A. Mailybaev, H. Yabuno, and H. Kaneko Abstract Straight elastically supported beams of variable width under the action of a periodic axial force are considered. Two shape optimization problems for reducing parametric resonance zones are studied. In the first problem, the minimal (critical) amplitude of the excitation force is maximized. ...

Еще в разделе: (Показать все результаты (>31) - mailybaev.imec.msu.ru/ )

• http://mailybaev.imec.msu.ru/reviews/Olhoff.pdf
• Multiparameter Stability Theory with Mechanical Applications

... 10, 63 ­ 64 (2010) / DOI 10.1002/pamm.201010024 Integrability and nonintegrability in terms of transcendental functions in dynamics of a rigid body Maxim V. Shamolin1, 1 Institute of Mechanics, Lomonosov Moscow State University, Michurinskii Ave., ... This circumstance allowed the author to perform a complete analysis of all phase trajectories and highlight those properties of them which exhibit the roughness and preserve for systems of a more general form. c 2010 Wiley-VCH Verlag GmbH & Co. ...

Еще в разделе: (Показать все результаты (>47) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-98-1.pdf
• http://shamolin2.imec.msu.ru/art-112.pdf
• http://shamolin2.imec.msu.ru/art-185-2.pdf

... We start with a simple case of the control system x = f (x, u), x M 2, u S1, on a two-dimensional manifold M whose tangent plane at each point is equipped with the set of admissible velocities Im , and assume that this set is a closed smooth curve. ... A supporting plane of a curve I = {r(t)} is a co-oriented plane whose open positive half-space does not contain points of I , and the plane itself contains points of I . ... Three points on a line form the support of a supporting plane. ...

Еще в разделе: (Показать все результаты (>23) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/Nekipelov_comment_on_reserve.pdf
• http://www.mse-msu.ru/Nekipelov_France_2010_Slides_Eng.pdf
• http://www.mse-msu.ru/images/Sapir_trnslt.pdf

... When embedded within a base document, a URL in its absolute form may contain a great deal of information which is already known from the context of that base document's retrieval, including the scheme, network location, and parts of the url-path. ... Introduction This document describes the syntax and semantics for "relative" Uniform Resource Locators (relative URLs): a compact representation of the location of a resource relative to an absolute base URL. ... 3.1) Base URL embedded in the | ...

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc2396.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1945.txt

... Department . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>15) - ani.cmc.msu.ru/ )

• The ASR Department at the CMC Faculty of Lomonosov MSU
• Alexander Valeryevich Pozdneev
• Alexander Valeryevich Pozdneev | Department of the Automation for Scientific

Information letter Dear colleagues! Faculty of Basic Medicine, Lomonosov Moscow State University and State Research Center ­ Institute for Biomedical Problems, Russian Academy of Science would like to invite you to participate in the work of the VII Russian National School with International Participation on Muscle and Exercise Physiology «New approaches to studying of classical problems». ... Abstracts of reports will be published. ... The receipt of your abstract will be confirmed by e-mail. ...

Еще в разделе: (Показать все результаты (>8) - www.fbm.msu.ru/ )

THE 75th NAME-LIST OF VARIABLE STARS. ... The 75th Name-List consists of two tables. ... the literature, taken from positional catalogues, including USNO A1.0/A2.0 and GSC, or determined by the authors); the range of variability (sometimes the column Min gives, in parentheses, the amplitude of light variation; the symbol ( means that the star , in minimum light, becomes fainter, than the magnitude indicated); and the system of magnitudes used ( P are photographic ...

Еще в разделе: (Показать все результаты (>19) - www.sai.msu.ru/ )

• Отдел внегалактической астрономии: ГАИШ Extra-galactic astronomy Group Student

... О факультете . ... The Second White Sea Molecular Zoology Summer School . ... N.A.Pertzov White Sea Biological Station (WSBS MSU) invites undergraduate and graduate students studying zoology and ecology to participate in summer field school on Molecular Zoology, which will take place in September 5-19, 2010. ... Overview of major groups of invertebrates inhabiting the White Sea, determination of species with taxonomic keys, primer on zoological drawings. ... Биологический факультет МГУ . ...

Еще в разделе: (Показать все результаты (>9) - www.bio.msu.ru/ )

HERMITE FUNCTIONS EXPANSION BASED NON-LOCAL MEANS ALGORITHM FOR CT-APPLICATIONS1 N. Mamaev2, A. Lukin3, D. Yurin4, M. Glazkova5, V. Sinitsin6 Laboratory of Mathematical Methods of Image Processing Faculty of Computational Mathematics and Cybernetics Lomonosov Moscow State University Leninskie Gory, Moscow 119991, Russia mamaev.nikolay93@mail.ru, 3lukin@ixbt.com, 4yurin@cs.msu.ru 5,6 Federal Center of Medicine and Rehabilitation Ivan'kovskoye sh., ... Noise in CT-images is close to Gaussian [3]. ...

Еще в разделе: (Показать все результаты (>21) - imaging.cs.msu.ru/ )

• http://imaging.cs.msu.ru/files/courses/ipintro2012/Lec_Pt2_MATLAB_Workshop_SHORT.pdf
• http://imaging.cs.msu.ru/pub/2013.PRIA.Levashov_Yurin.RidgeAndTree.en.pdf
• Imaging lab: people

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

Department of Physics, Lomonosov Moscow State University . Laboratory "Сryoelectronics" . Laboratory of Cryoelectronics (LCE) was established in the beginning of 1988 on the base of scientific group of Prof. Konstantin K. Likharev originated in 70-th at Physics Department of Moscow State University. ... As it was circumstantially formed, two organizations equipped our laboratory: the Physical Department of MSU and the section of Microelectronics of SIMP (NIIYaF) MSU. ...

Еще в разделе: (Показать все результаты (>35) - cryolab.phys.msu.ru/ )

• About laboratory

On-line Data . COHO data . ... PIONEER 10 . ... PIONEER VENUS ORBITER . OMNI data . OMNI Data Set . LASRE data . CORONAS-I (electrons) . CORONAS-I (protons) . ... COSMOS 1686 (electrons) . COSMOS 1686 (protons) . ... Satellite Informations Selector . ... AKEBONO AMPTE Cluster II / Phoenix DMSP Dynamics Explorer (DE) Equator-S FAST Freja GOES-7 GOES-8 Geotail Hawkeye IMAGE (GSFC) IMAGE (SwRI) IMP-8 ISEE Interball LANL MSX Oersted POLAR SAMPEX SOHO UARS Ulysses Voyager WIND . ...

Еще в разделе: (Показать все результаты (>13) - dbserv.sinp.msu.ru/ )

• ULYSSES Online Data Set Selector

. Показ слайдов для альбома :: Защита дипломных работ 22.12.2008 . Показ слайдов . Fullscreen applet [Современные браузеры] [Совместимые, но с ограничениями] . Галерея: Список альбомов Альбом: Защита дипломных работ 22.12.2008 . If you don't have the Java Plugin 1.4 or later, or you don't want to wait for the applet to download, you can use one of the non-fullscreen versions. Your browser doesn't support applets; you should use one of the other slideshow methods. Powered by Gallery v1.4.3-RC3 .

Еще в разделе: (Показать все результаты (>35) - hep.msu.dubna.ru/ )

• Показ слайдов для альбома :: Cеминар Нобелевского лауреата по физике Дэвида
• Показ слайдов для альбома :: Экскурсия студентов третьего курса в Дубну. Осень
• Показ слайдов для альбома :: Картинки

. This page uses frames, but your browser doesn't support them.

Еще в разделе: (Показать все результаты (>5) - optics.sinp.msu.ru/ )

• ABOUT PARTICULARITIES OF INTENSITIES DISTRIBUTION IN CROSS-SECTION OF POWERFUL

. This page uses frames, but your browser doesn't support them.

Еще в разделе: (Показать все результаты (>117) - www.enzyme.chem.msu.ru/ )

• Efremenko E.N.
• Group of microbial biochemistry and biotechnology
• Gudkov D.A.

The Nine Planets is best viewed on-line via a graphical WWW browser which displays the pictures in color and supports hypertext link traversal. ... To view the movies and hear the sounds, you'll need additional helper programs. ... I recommend that you use Netscape as your browser. Netscape can display gif and jpeg images directly without need of any additional helper apps. You do need additional helper apps for movies and sounds, however. ... Yahoo's Helper Applications .. ... Tech Help .. ...

Еще в разделе: (Показать все результаты (>2) - www.iki.rssi.ru/ )

. Previous Next Galleries . The "support" group. Previous Next Galleries

Еще в разделе: (Показать все результаты (>31) - www.inorg.chem.msu.ru/ )

• V.A. Prituzhalov

. Показ слайдов для альбома :: 40-летие Филиала МГУ . Показ слайдов . Fullscreen applet [Современные браузеры] [Совместимые, но с ограничениями] . Галерея: Филиал МГУ в Дубне Альбом: 40-летие Филиала МГУ . If you don't have the Java Plugin 1.4 or later, or you don't want to wait for the applet to download, you can use one of the non-fullscreen versions. Your browser doesn't support applets; you should use one of the other slideshow methods. Powered by Gallery v1.4.3-RC3 .

Еще в разделе: (Показать все результаты (>10) - www.msu.dubna.ru/ )

• Показ слайдов для альбома :: Школы
• Показ слайдов для альбома :: ОИЯИ
• Показ слайдов для альбома :: В аудиториях филиала

Moscow State University . INTERNATIONAL CONFERENCE . ... Moscow, Russia . ... Institute of Mechanics of MSU . ... The aim of this Conference is gathering active researchers and students in the field of nonlinear fluid dynamics in order to provide a forum for discussions. Since 1976 through 2008 the Conference was organized by the Institute of Mechanics of Moscow State University (see http://hit2003.narod.ru/ ). ... Institute of Mechanics , Moscow State University . ...

Еще в разделе: (Показать все результаты (>31) - hit-conf.imec.msu.ru/ )

LUT Summer School: www.lut.fi/summerschool summerschool@lut.fi Guide for Student Advisers Greetings from your colleagues at Lappeenranta University of Technology! ... With the wide-ranging selection of courses on-offer during the LUT Summer School we aim to both challenge and inspire students. ... Lappeenranta and LUT Lappeenranta is located some 220 km northeast of Finland's capital, and about 230 km northwest of St. Petersburg, Russia. ... The fee will be given on the LUT Summer School web pages. ...

Еще в разделе: (Показать все результаты (>11) - www.phys.msu.ru/ )

• online journals
• Alumni Association
• Giving to the Faculty