... Veselovsky, V.A., Djanumov D.A. The use of biophysical methods in the study of adaptive reactions of plants, in connection with the problem of resistance. ... Kulaeva, O.N., Mikulovich T.P., Veselova, T.V., Veselovsky, V.A., Kukina, I.M., Klyueva N.Yu. ... Veselovsky, V.A., Veselova T.V . ... Nauka, Moscow (in Russian).1990. 200 p. Veselova T.V., Veselovsky V.A., Chernavsky D.S. Stress of Plant: A Biophysical Approach. ... Veselova T.V., Veselovsky V.A. Photosynthesis and stress of plant cells. ...

Еще в разделе: (Показать все результаты (>5) - biophys.msu.ru/ )

Cost and time schedule 10 Cost and time schedule In this chapter, a summar y of the complete project cost is given, the basic schedule from star t of construction until end of commissioning is discussed and the resulting budget profile over all phases of the project is described. ... 20 XFEL TDR.indb 620 12/10/2007 15:28:06 Cost and time schedule Figure 10.1.1 Breakdown of project construction cost (sum of capital investment and personnel cost) into the work package groups. ... Figure10.5.3 project. ...

Еще в разделе: (Показать все результаты (>174) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/conf/epp10/Nozaki.pdf
• http://nuclphys.sinp.msu.ru/conf/XFEL/XFEL-TDR_Chapter08_Commissioning-Operation.pdf
• Альфа-распад (измерения)

International Laser Center of MSU . ... Education . ... Laser Graduate School . ... Home Education Continuing Education and Retraining Program . The International Laser Center of Moscow State University accepts visiting scholars from all over the world for training programs in laser physics and technologies. The ILC offers the following continuing education and retraining programs in these fields: . ... International Retraining and Post-docs Program; . Laser Graduate School short courses . ...

Еще в разделе: (Показать все результаты (>59) - ilc.phys.msu.ru/ )

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>59) - www.msm.biophys.msu.ru/ )

PRL 105, 010404 (2010) PHYSICAL REVIEW LET TE RS week ending 2 JULY 2010 Statistical Estimation of the Efficiency of Quantum State Tomography Protocols Yu. ... It is based on a priori estimation of the quality of an arbitrary protocol by means of universal asymptotic fidelity distribution and condition number, which takes minimal value for better protocol. ... The present approach allows to analyze arbitrary protocols of statistical reconstruction of quantum states. ... 1] M. Genovese, Phys. Rep. ...

Еще в разделе: (Показать все результаты (>77) - qi.phys.msu.ru/ )

• http://qi.phys.msu.ru/papers/2011-pra-84-042108.pdf
• http://qi.phys.msu.su/papers/2007-nato-11-123.pdf
• http://qi.phys.msu.ru/kulik/Papers/JETP10_03KrivitskiiLO.pdf

... 8 DOI: 10.1093/nar/gkh583 Mapping of the second tetracycline binding site on the ribosomal small subunit of E.coli Maria M. Anokhina1, Andrea Barta2, Knud H. Nierhaus3, Vera A. Spiridonova4 and Alexei M. Kopylov1,4,* Department of Chemistry ... University, 119992 Moscow, Russian Federation Received February 5, 2004; Revised March 22, 2004; Accepted April 14, 2004 1 ABSTRACT Tetracycline blocks stable binding of aminoacyltRNA to the bacterial ...

Еще в разделе: (Показать все результаты (>6) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2002_1.pdf
• http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf

... О факультете . ... Master In Ecology . ... Master (MSc) . ... A Master will be able to successfully deal with conceptual issues and practical problems related to various subflields of ecology and environmental science. ... Enables the students to develop biopolicies to deal with ecological problems caused by environmental pollution, the disruption of the ecological matrix of an area, and biodiversity-endangering factors. ... Lectures . ... Д 501.001.20 - все защиты . ... Биологический факультет МГУ ...

Еще в разделе: (Показать все результаты (>3) - www.bio.msu.ru/ )

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ POST- DISASTER TECHNICAL CLEARINGHOUSES: AN OPERATIONAL MODEL FOR TSUNAMIS IN HAWAII Laura S. L. Kong 1, Brian Yanagi 2, Stan Goosby 3, Ray Isawa 4, Dan Walker 5, George Curtis International Tsunami Information Center, Honolulu, Hawaii , USA E-mail: Laura.Kong@noaa.gov 2 Hawaii ...

Еще в разделе: (Показать все результаты (>23) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E06_Gusiakov.pdf
• http://seac47-2.phys.msu.ru/proc/Foreword.pdf
• LOCAL TSUNAMI WARNING AND MITIGATION -- Official information

Control of Diffeomorphisms and Densities Andrei A. Agrachev SISSA, Trieste, Italy and Steklov Mathematical Institute, Moscow, Russia e-mail: agrachev@sissa.it Consider a classical control system as it was defined by Pontryagin: x = f (x, u), x M , u U. (1) Assume that the state space M is a smooth manifold , the set of control parameters U is a closed subset of another smooth manifold , the righthand side f is ...

Еще в разделе: (Показать все результаты (>23) - pont2008.cmc.msu.ru/ )

... Флогистон / konservator . ... Сайт: http://juliana-puchkova.ru/ . ... Основной метод - аналитическая психология (юнгианский анализ), в том числе толкование сновидений и песочная терапия. ... В 2009-2010 г.г. - участник методического семинара Е.А. Пуртовой (разработка авторской программы по развитию символического мышления у психологов, психотерапевтов, аналитиков). ... Что такое юнгианская супервизия?". - журнал Высшей школы психологии "Юнгианский анализ", ?1, 2010. ( http://www.maap.ru/learn/38/ ) ...

Еще в разделе: (Показать все результаты (>22) - www.flogiston.ru/ )

... A p P EC Astropar ticle Physics for Europe · Cosmic rays: A large array for the detection of charged cosmic rays ( Auger North) · Gamma rays: A large array of Cherenkov Telescopes for detection of cosmic high energy gamma-rays ( CTA ) · High energy neutrinos: A cubic kilometre-scale neutrino telescope in the Mediterranean (KM3NeT) · Dark matter search: Ton-scale detectors ... A p P EC Astropar ticle Physics for Europe · Cosmic rays: ­ ­ ­ ­ ­ AMS detector launched. ...

Еще в разделе: (Показать все результаты (>6) - tunka.sinp.msu.ru/ )

... REVIEWS Measurement and Physical Content of Quantum Information B. A. Grishanin and V. N. Zadkov Received January 15, 2002 Abstract--Basic quantum information measures involved in the information analysis of quantum systems are considered. ... But today, it has become possible to intentionally vary directly quantum states of elementary quantum systems. ... 9 2002 MEASUREMENT AND PHYSICAL CONTENT OF QUANTUM INFORMATION 935 its information-equivalent copy is at the input and output. ...

Еще в разделе: (Показать все результаты (>71) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/Laser-Phys-Lett-2004.pdf
• http://qilab.phys.msu.ru/papers/VMU-No.%205,%20pp.%20315-320%20(2008)-EN.pdf
• http://qilab.phys.msu.ru/papers/PRA22309.pdf

SITE 2010 Comprehensive Characterization of Astronomical Sites Kislovodsk, Russia, 49 October 2010 Conference Summary Marc S. Sarazin*a a European Southern Observatory, Garching, Germany Abstract The main topics discussed during the Site 2010 conference are outlined and the outcome is described. Keywords: Astronomical Site testing, precipitable water vapor, atmospheric turbulence, cloudiness, seeing 1. ... Site surveys for National observatory projects in China, India, and Iran benefit from this. ...

Еще в разделе: (Показать все результаты (>19) - site2010.sai.msu.ru/ )

• Information
• General information

... Co-Chairman of the Forum ­ Deputy Secretary of the Security Council of the Russian Federation , Sergey M. BURAVLEV Co-Chairman of the Forum ­ Adviser of the Security Council of Russian Federation , Director of Lomonosov Moscow State University Institute of Information Security Issues, Vladislav P. SHERSTYUK Co-Chairman of the Forum ­ Special Representative of the President of the Russian Official languages: Russian, English. ...

Еще в разделе: (Показать все результаты (>15) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/bayern2009/perl.doc
• http://www.iisi.msu.ru/UserFiles/File/bayern2009/global_dns.pdf
• http://www.iisi.msu.ru/UserFiles/File/bayern2009/malisevic.doc

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• Nhunt: program for nucleic acid sequence similarity search

... Reversibility of nucleoside diphosphate kinase solubilization from the surface of the outer mitochondrial membrane. ... It was found that in medium with low ionic strength nucleoside diphosphate kinase (NDPK) solubilization from the outer membrane of liver mitochondria could be partially reversed by the addition of 3.3 mM MgCl2. ... After solubilization of NDPK in the absence of leupeptin, cathepsins damage sites of its binding on the membranes. ...

Еще в разделе: (Показать все результаты (>72) - biochem.bio.msu.ru/ )

• Probable participation of 14-3-3 in tau protein oligomerization and...
• Synergetic inhibition of the brain mitochondrial NADH:ubiquinone oxidoreductase
• Biochemistry Department of Moscow State University | Special curses

Bird Species Database (BSD) is being compiled in a framework of the Arctic Birds Breeding Conditions Survey (ABBCS) of the International Wader Study Group (IWSG). BSD aims at providing information on distribution, numbers and breeding status of birds in the Arctic, with the focus on last-breaking and, thus usually unpublished information. The primary source of data is questionnaires filled in by contributors to the ABBCS, while data from literature are being added occasionally. ... breeding . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

... Electronic journal Issue 4. 10 september 2004 Vorontchuk, Cox III R.W. Developing a Competency-based Career Training and Professional Development Program for Latvia INTRODUCTION. ... With the support of a grant from the NISPAcee a team from the Latvian School of Public Administration, the University of Latvia and the University of Akron (Ohio, USA) prepared for the Chancellery of Latvia a proposal for the creation of a career-long professional development program for those in the civil service. ...

Еще в разделе: (Показать все результаты (>8) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./nekipelov.pdf

Software on Data Processing . We Offer Statistical Software And . Software On Data Analysis And Processing. ... The package is intended for those, who doesn't have large experience in statistical analysis, but needs a quick and convenient data processing tool. ... Package provides full complex of registration and analysis methods, individual EKG monitor-analyzer, special tools for complete polygraph analysis. price: 700$ - 2200$. phone number (095) 437-3695, 155-1365 . ... InCo . ...

Еще в разделе: (Показать все результаты (>2) - statsoft.msu.ru/ )

• InCo literature in English

... Vernadsky's year in Russia and in the world Results of Rosprirodnadzor activities in 2012 Ideas of sustainable development in the creative heritage of Vladimir Vernadsky Government hour in the State Duma The Foresight Centre on the Priority Environmental Management Earth Hour in Russia Initiative for new national park in Moscow region Improving Russian economy's energy and ... Source: Press Service of the Ministry of Natural Resources and Environment of the Russian Federation. ...

Еще в разделе: (Показать все результаты (>47) - eng.geogr.msu.ru/ )

• http://www.eng.geogr.msu.ru/science/newsletter/2_12.pdf