Создание и оценка цифровых моделей рельефа высокой точности для урбанизированных территорий на основе цифровой картограф. продукции. Creating and evaluating high resolution DEM's for an urban environment from digital cartographic products / Carter J. R., Tripathy D. // 21 International Cartographic Conference "Cartographic Renaissance", Durban , 10-16 Aug., 2003. ... Durban, 2003, 10-16 Aug., ... С. 1851-1858. ...

Еще в разделе: (Показать все результаты (>10) - ecoinformatica.srcc.msu.ru/ )

... Магистерское образование . ... Магистерские программы . ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Open Information systems? and ?Network software?. ... Are researched the most frequently used applied protocols of net security and protocol of creating virtual private nets. ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Program devices of net?. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...

Еще в разделе: (Показать все результаты (>12) - hcs.cmc.msu.ru/ )

• Master program "Enterprise Information Systems" | Магистерское и послевузовское

... О проекте . ... The possibility of the creation and the application prospects of the laser-electron X-ray generator based on Thompson scattering of laser radiation on a bunch of relativistic electrons are considered. ... The layout of beam-lines and experimental stations intended for the applications of the X-ray laser-electron generator to the investigation of the elemental composition, material structure and biological objects is discussed. ...

Еще в разделе: (Показать все результаты (>5) - miles.sinp.msu.ru/ )

. This crossword was created with EclipseCrossword - www.eclipsecrossword.com . 1 . 2 . 3 . 4 . 5 . 6 . 7 . 8 . 9 . Этот кроссворд был создан freeware EclipseCrossword

Еще в разделе: (Показать все результаты (>2) - prac-gw.sinp.msu.ru/ )

. Rolling Simplexes and their Commensurability. (Axiom and Criterion of Incompressibility, Momentum Lemma) / Razmyslov Yu.P. // Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. 2011. ? 5. P. 55-58 [Moscow Univ. Math. Bulletin. Vol. 66, N 5, 2011.]. The total geometrical theory of field is recreated. Key words : projective plane, affine chart, rolling, incompressibility, desargues condition, field. ? 5/2011 . Toggle formulas format . (LaTeX / SVG)

Еще в разделе: (Показать все результаты (>79) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika N 4/2014

PHYSICAL REVIEW A, VOLUME 61, 052305 Analysis of radiatively stable entanglement in a system of two dipole-interacting three-level atoms I. V. Bargatin, B. A. Grishanin, and V. N. Zadkov International Laser Center and Department of Physics, M. V. Lomonosov Moscow State University, Moscow 119899, Russia Received 29 November 1999; published 7 April 2000 We explore the possibilities of creating radiatively stable entangled states of ... II only two transitions in the whole system. ...

Еще в разделе: (Показать все результаты (>78) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/PRA22309.pdf
• http://qilab.phys.msu.ru/papers/FortschrPhys-2000-en.pdf
• http://qilab.phys.msu.ru/papers/UFN-2001-44(6)-en.pdf

... - behave-, believe-, blurred-, body- border- both-; ... , ... bottom-, bursary- but-, , ; ; , calculate-, capable-, , carry-, ~ away - ~out- Cartesian- case-, cause-; cathode- centre- 4 certainly-, champion- (- ), , , change-, , characterise-() characteristic-, ... weight- whereas- while-, whole-, wide-, , width- witness-, wonder- no ~ - worth- to be ~ doing smth- - Y yield- Z zinc- 35 ...

Еще в разделе: (Показать все результаты (>22) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Academic_English_part2.pdf
• http://www.eng.math.msu.su/download/last_year_theses_by_A_Rakitko.pdf

... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...

Еще в разделе: (Показать все результаты (>2) - www.ccl.msu.su/ )

LUT Summer School: www.lut.fi/summerschool summerschool@lut.fi Guide for Student Advisers Greetings from your colleagues at Lappeenranta University of Technology! ... With the wide-ranging selection of courses on-offer during the LUT Summer School we aim to both challenge and inspire students. ... Lappeenranta and LUT Lappeenranta is located some 220 km northeast of Finland's capital, and about 230 km northwest of St. Petersburg, Russia. ... The fee will be given on the LUT Summer School web pages. ...

Еще в разделе: (Показать все результаты (>2) - www.phys.msu.ru/ )

О НЕУСТОЙЧИВОСТИ СХОДЯЩИХСЯ УДАРНЫХ ВОЛН ПОЛИГОНАЛЬНОЙ ФОРМЫ А.В. Конюхов, А.П. Лихачев Объединенный институт высоких температур РАН, Москва Как известно [1], сходящиеся цилиндрические (сферические) ударные волны неустойчивы по отношению к потере пространственной симметрии с тенденцией к возникновению полигональной (полиэдральной) формы. ... Whitham, G. B., 1974 Linear and Non-linear Waves. ... Schwendeman, D. W., Whitham, G. B. On converging shock waves // Proc. R. Soc. ...

Еще в разделе: (Показать все результаты (>10) - hit-conf.imec.msu.ru/ )

... The colleges had gathered a lot of experience in upbringing of young people. ... Keywords: historical anthropology, cultural history, daily city life, women's education, modernisation, school medicine, empress Maria's establishments, closed girls' colleges Strokina A.N., Butareva I.I. Ergonomics measurements of body schoolchildren (p. 30) The article presents the children's body size, intended for the construction of facilities and activities for communities associated with their use of spaces. ...

Еще в разделе: (Показать все результаты (>24) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2013_1.doc
• http://www.antropos.msu.ru/vestnic/e2013_4.doc
• http://www.antropos.msu.ru/vestnic/e2014_2.doc

... 2006 ARTICLE I. NAME AND PURPOSE Section 1. ... C. Secretary: The Secretary shall be the custodian of the records of the IHSS, maintain an up-to-date list of members in collaboration with the Vice President/President Elect and Chapter Coordinators, maintain minutes of all membership and Board meetings, conduct or supervise the correspondence of the IHSS, serve as editor of the IHSS Newsletter, and shall perform such other duties that may be delegated by the President, Vice President or the Board. ...

Еще в разделе: (Показать все результаты (>110) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/ihss/pdf/NL_42.pdf
• http://www.mgumus.chem.msu.ru/ihss/pdf/nl_36.pdf
• http://www.mgumus.chem.msu.ru/publication/2006/2006-perminova-synthesis.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

4 SPIN. ... 0 1 Hello, world! ( ) ";" , active proctype main() { printf("Hello, world!\n") } ґ , >spin hello.pml Hello, world! 1 process created Hello, world! ... mtype = { P, C }; mtype turn = P; active proctype producer() { do :: ( turn == P) - printf( Produce\n ); turn = C od } active proctype consumer() { do :: ( turn == C) - printf( Consume\n ); turn = P od } ( 1) ґ 0, (op on sequence) (guard) ґ mtype = { P, C }; mtype turn = P; active proctype producer() { do :: ( ...

Еще в разделе: (Показать все результаты (>2) - savenkov.lvk.cs.msu.su/ )

• http://savenkov.lvk.cs.msu.su/mc/lect02.pdf