... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...
... Изучение работы оптического измерителя вибраций Цель задачи Настоящая работа ставит целью ознакомить с действием лазерного измерителя малых колебаний, построенного на принципе интерферометра Майкельсона [1,2] и методами измерения амплитуды колебаний в диапазоне 1 - 100 нм в звуковом диапазоне частот. ... колебании зеркала [pic] с амплитудой [pic] и рабочей точки [pic] | pic] | ... Амплитуду колебаний A в этом случае можно определить из анализа соотношения гармоник в окрестности частоты [pic]. ...
О КАФЕДРЕ . ... Дело в том, что сильное землетрясение не является обособленным актом разрушения литосферы Земли. ... В физическом отношении землетрясение является процессом разрушения сильно неоднородного вещества Земли, а проблема выяснения физики сейсмического процесса сводится к проблеме прочности неоднородных структурированных сред. ... Мониторинг высотного здания МГУ . В 2005 году кафедра физики Земли выступила инициатором восстановления работ по мониторингу высотного здания МГУ . ...
... The traditional answer to this question is unequivocal: тАЬno, public scholarship cannot and should not exist.тАЭ To popularize knowledge is to simplify, and simplification risks the loss of nuance and complexity, the very essence of scholarly knowledge. ... The public sphere can know but a distorted version of scholarly knowledge. ... You need JavaScript enabled to view it. (with Summer School-2016 in the subject line) before April 25, 2016. ... Summer School Archives . ...
... Ядро МАТЛАБ содержит более тысячи функций. ... Кадр из анимационной сцены [pic] Исходный код S- функции , написанной на языке C++ с использованием библиотеки OpenGL для отображения анимационной картинки перемещения маятника на движущейся ... _GENERATE_TLC 1 #define SOURCEFILES #define PANELINDEX 6 #define SFUNWIZ_REVISION 2.0 #include simstruc.h static double x1 = 0, x2 = 0, x1_ = 0, x2_ = 0, X = 0; static double l1,l2; static int glInited = 0; static HWND hGlWindow = NULL ; static ...
[
Текст
]
Ссылки http://ndsipu.cmc.msu.ru/files/Kraev/MATLAB_FOR_STUDENTS.DOC -- 475.0 Кб -- 25.02.2008 Похожие документы
... XI--XVII . ... Ac A d e m I c r e A d I N g S Conference «Old Russian literature and television» M.V. Ivanova. old russian literature and contemporary russian television . ... e-mail: lanskoy@mail.ru. ... online. 28 2007, 13:00. http://www. expert.ru/interview/2007/03/28/pavlovsky/ 21 , , , . ... 2006, 39. http://www.expert. ru/printissues/expert/2006/39/prodazha_livejournal/print 22 , . ... 2007, 31. . ... 1917--1918 . ... Key words: Old Russian literature, plot, demonology, old printing Prologue. ...
[
Текст
]
Ссылки http://www.ftv.msu.ru/hst-notes/notes_2.pdf -- 1574.8 Кб -- 06.12.2010
[
Текст
]
Ссылки http://ftv.msu.ru/hst-notes/notes_2.pdf -- 1574.8 Кб -- 06.12.2010 Похожие документы
УЧЕБНОЕ ПОСОБИЕ ПО АНГЛИЙСКОМУ ЯЗЫКУ ДЛЯ СТУДЕНТОВ-ГЕОЛОГОВ 1 КУРСА ЧАСТЬ 1 Н.Г.КИТКОВА, Т.Ю.САФЬЯННИКОВА Рецензенты: Д.г.-м.н., профессор МГУ имени М.В.Ломоносова Н.В.Короновский К.ф.н., заведующая кафедрой иностранных языков РГГУ нефти и газа имени Губкина Е.Ю.Симакова Содержание Introductory Section A scientist Studies Science Section I. Meet the Sciences Unit I: What is Science? Unit II: Geology as a Science Unit III: Branches of Geology Unit IV: The Importance of being a Geologist Unit V: Revision
[
Текст
]
Ссылки http://www.geol.msu.ru/obsh/uch_ch1.doc -- 1082.0 Кб -- 08.04.2016
[
Текст
]
Ссылки http://geol.msu.ru/obsh/uch_ch1.doc -- 1082.0 Кб -- 08.04.2016 Похожие документы
The Lomonosov Moscow State University Faculty of Educational Studies The MSU FES offers various educational programs: 1. Master program "Education Management"; 2. ... Qualification training programs "School Teacher" and "Higher School Teacher". The FES was founded in 1997 with the main goal to teach those students of the MSU faculties who wished to receive the qualification of Secondary and Higher School teacher & lecturer in addition to their basic speciality. ...
[
Текст
]
Ссылки http://www.fpo.msu.ru/open_files/fpo2015_eng.pdf -- 81.9 Кб -- 31.10.2015
[
Текст
]
Ссылки http://fpo.msu.ru/open_files/fpo2015_eng.pdf -- 81.9 Кб -- 31.10.2015 Похожие документы
... В левой части открывшегося окна Group Policy найдите раздел Local Computer Policy | ... Windows Update . ... Дважды щелкните по строке Configure Automatic Updates , в открывшемся окне поставьте переключатель в положение Enabled. ... Задав настройки для параметра Configure Automatic Updates, щелкните Next Policy и в окне Specify intranet Microsoft update service location Properties поставьте переключатель в положение Enabled, а в обоих полях ввода текста обязательно введите http://wsus.chem.msu.ru . ...
Dear friends, It is less than three weeks left till the 39th IChO starts. ... Currency and cards. Russian rouble is the only currency accepted throughout Russia. ... To attention of Head mentors intending to pay fees on arrival in cash: payments will be accepted in Russian roubles only. ... During the IChO, mentors and guests will stay in Holiday Inn Sokolniki, and students in the Olympian camp, which is also an option for early arrivals and late departures. ... The 39th IChO Organizing Committee ...
[
Текст
]
Ссылки http://www.icho39.chem.msu.ru/html/english/Participation/Pre-arrival%20circular.pdf -- 9.7 Кб -- 29.06.2007
[
Текст
]
Ссылки http://icho39.chem.msu.ru/html/english/Participation/Pre-arrival%20circular.pdf -- 9.7 Кб -- 29.06.2007 Похожие документы
. Strict Standards : Non-static method JLoader::import() should not be called statically in /wcmc/ms/ms/libraries/joomla/import.php on line 29 . Strict Standards : Non-static method JLoader::register() should not be called statically in /wcmc/ms/ms/libraries/loader.php on line 71 . Strict Standards : Non-static method JLoader::import() should not be called statically in /wcmc/ms/ms/libraries/joomla/import.php on line 32 . Strict Standards : Non-static method JLoader::register() should not be called
... кафедра Исследования операций . ... Приветствие Традиционные темы конференции Основные даты Оформление тезисов Регистрация Программа конференции Размещение Программный коммитет Организационный коммитет Координаторы Контактная информация . ... 10-14 апреля 2007 Программа конференции . ... академик РАН А.А. Петров . ... А.В. Кузнецова, В.И.Лукьянов, О.А.Максакова, И.С.Меньшиков, О.Р. Меньшикова, О.В. Сенько . ... секция . ... МГУ, ВМК, ауд. ... 11 апреля 2007 . ... среда, 11 апреля 2007, ауд. ...
The Shigeyoshi Matsumae Stadium in Moscow University was opened on September 1, 1989, on the campus of Moscow University, as the first full-scale stadium having artificial turf in the Soviet Union (at that time). ... The stadium was a gift by Tokai University to Moscow University, as the result of more than 20 years of exchange and friendship between Tokai University and Moscow University in exchanging students and teachers, as well as academic and cultural works since 1973. ...
... 000, 112 (2009) Printed 11 February 2010 A (MN L TEX style file v2.2) Analytical approximations of K -corrections in optical and near-infrared bands I1gor V. Chilingarian1 2 ,2,3 , Anne-Laure Melchior 1,4 and Ivan Yu. ... Received 2010 February 01; in original form 2009 August 14 ABSTRACT To compare photometric properties of galaxies at different redshifts, the fluxes need to be corrected for the changes of effective rest-frame wavelengths of filter bandpasses, called K -corrections. ... Table 1. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... 3.6 . ... 50% 3) 3) &1 Principles of multiprocessor computer systems design on basis of FPGA I.A. Kaliaev1, I.I. Levin1, E.A. Semernikov 2 1) SRI of multiprocessor computer systems of academician A.V. Kaliaev of Southern federal university (Taganrog) 2) Southern scientific center of Russian academy of sciences (Rostov-on-Don) Abstract In the article are given principles of high-performance computer systems design on basis of reconfigurable element base. ... 3& 5 Argus v.3.0; .& ... COLAMO v.2.0; .6 ...
ДД PROCEEDINGS OF THE 31st ICRC, LODZ 2009 1 Preliminary Proton and Helium Spectra from the CREAM-III Flight Y. S. Yoon , H. S. Ahn , T. Anderson, L. Barbier?, ... Keywords: CREAM; energy spectra; protons and helium nuclei I . ... CREAM-III I N S T RU M E N T A N D F LIGHT The CREAM-III instrument consisted of a tungsten/scintillating fiber calorimeter, a dual layer Silicon Charge Detector (SCD), a Cherenkov Camera (CherCam), a Cherenkov Detector, and a Timing Charge Detector (TCD). ...
... Предмет клеточной биологии (цитологии), история изучения клетки, методы клеточной биологии (световая и электронная микроскопия, флуоресцентная микроскопия, иммуноцитохимия, цитохимия, методы культуры клеток, клеточная гибридизация, компьютерная видеомикроскопия, метод выявления клеточных структур in vivo с помощью флюоресцентных белков); связь клеточной биологии с гистологией, молекулярной биологией, генетикой, биохимией и биологией развития; практическое применение достижений клеточной биологии. ...