. General Information . News . Organizing Committee . Program . Registration . Registered participants . Symposium expenses . Accommodation and meal . Important deadlines . Presentation information . Abstract submission . Cultural Program . Travel information . Contact information . 14 European Symposium on . Gas Phase Electron Diffraction . 24-28 June 2011 . M. V. Lomonosov Moscow State University . 1 February 2011 . deadline for Registration . 20 April 2011 . deadline for Abstract submission .

Еще в разделе: (Показать все результаты (>3) - ged.chem.msu.ru/ )

... These spectral characteristics compare with introduction (ВВЕДЕНИЕ) At last time many workers have studied thermal Rayleigh-Benard convection using numerical At last time many workers have studied thermal Rayleigh- Benard convection using numerical time many At last time many workers have studied thermal Rayleigh-Benard convection using numerical used spectral methods with periodic boundary conditions. ... In numerical simulations were derived secondary stationary, [pic] where ? ...

Еще в разделе: (Показать все результаты (>27) - hit-conf.imec.msu.ru/ )

• Nonlinear Problems of Gydrodynamic Stability Theory
• Moscow 2006

... News . About choir . ... Performance the Academic Choir of the Moscow State University in Crocus City Hall . ... Bishop Tikhon opened the choir of Moscow State University in Vienna . Choir of Moscow State University spoke at the Vienna branch of the United Nations . ... 2015 . ... Friday February 6th, 2015 . Posted in: News . ... Solemn meeting dedicated to the 260th anniversary of the founding of Moscow University . Concert at Moscow Conservatory Main Hall . ...

Еще в разделе: (Показать все результаты (>3) - new.choir.msu.ru/ )

... Home News Program Committee Organizing Committee Program Plenaries Special Sessions Registration Abstracts Accommodation Important dates Contacts Poster Links Conference Venue Video . Important dates . ... The beginning of the conference: June 17, 2008 . The closing of the conference: June 22, 2008 . ...

Еще в разделе: (Показать все результаты (>19) - pont2008.cmc.msu.ru/ )

• Registration International Conference Differential Equations and Topology
• Abstracts International Conference Differential Equations and Topology
• Deadline extension International Conference Differential Equations and Topology

... For students . ... 25 February 2016 We congratulate Plastinin Ivan and Vervald Alexey who have become PhD students! 25 January 2016 We congratulate Kirill Laprinskiy who won scholarship of M.V. Lomonosov for the young scientists! ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>22) - rswater.phys.msu.ru/ )

... Parts 3 and 4 give details of the ERC grant schemes, submission and evaluation while Part 5 lists other activities to allow the Scientific Council of the ERC to carry out its duties. ... 3.5 ERC Starting Grant proposal description .. 3.6 ERC Starting Grant proposal submission procedure and peer review evaluation .. ... The proposal must be submitted to the appropriate primary ERC panel (i.e. the panel which covers the main scientific areas of the research proposed) before the respective deadline. ...

Еще в разделе: (Показать все результаты (>32) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/work_programme_2012.pdf
• http://ideas.msu.ru/docs/ERC_work_programme_2010.pdf
• http://ideas.msu.ru/docs/Decision_fp7.pdf

Подписка на рассылку обзоров astro-ph на Subscribe.Ru . ... Обзоры УФН . ... Регистрация на RHESSI высокочастотных рентгеновских осцилляций в хвосте гипервспышки SGR 1806-20 . ... Ограничения на остывание нейтронных звезд для случая цветной сверхпроводимости гибридных звезд . ... Обзоры препринтов astro-ph . ... Comments: 30 pages, 12 figures, 2 tables. 79th Annual Scientific Meeting of the Astronomische Gesellschaft 2005, Karl-Schwarzschild-Lecture, to appear in Reviews in Modern Astronomy, 19, 1 . ...

Еще в разделе: (Показать все результаты (>150) - astro.uni-altai.ru/ )

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Borexino . ... SCIENCE AND TECHNOLOGY OF BOREXINO: A REAL TIME DETECTOR FOR LOW ENERGY SOLAR NEUTRINOS (pdf) . Solar neutrino experiments and Borexino perspectives (pdf) . Detection of Supernova Neutrinos by Neutrino-Proton Elastic Scattering (pdf) . BOREXINO: A REAL TIME LIQUID SCINTILLATOR DETECTOR FOR LOW ENERGY SOLAR NEUTRINO STUDY (pdf) . Confronting Spin Flavor Solutions of the Solar Neutrino Problem with current and future solar neutrino data (pdf) . ... CAN 2.0 стандарт (pdf) . ...

Еще в разделе: (Показать все результаты (>2) - vserv.sinp.msu.ru/ )

... Statistics in Medicine [Stat Med] . Common information . ... no information] . ... 0277-6715 . ... since 1982-01-01 till today . ... subscription - $3270,single article - $32 . ... medicine . ... http://www3.interscience.wiley.com/cg.. ... 1982-01-01 . today . ...

Еще в разделе: (Показать все результаты (>44) - journals.genebee.msu.ru/ )

• JCatalog - Science Magazines Catalog
• JCatalog - Список журналов

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>15) - swx.sinp.msu.ru/ )

• SWX - Главная
• SWX - Данные
• SWX - Магнитосфера

. February 999 . Mon . Tue . Wed . Thu . Fri . Sat . Sun . 1 . 2 . 3 . 4 . 5 . 6 . 7 . 8 . 9 . 10 . 11 . 12 . 13 . 14 . 15 . 16 . 17 . 18 . 19 . 20 . 21 . 22 . 23 . 24 . 25 . 26 . 27 . 28 .

Еще в разделе: (Показать все результаты (>4490) - fmp.msu.ru/ )

• http://fmp.msu.ru/index.php?option=com_k2&view=itemlist&task=calendar&month=2&year=10&catid=35&Itemid=1165
• http://fmp.msu.ru/index.php?option=com_k2&view=itemlist&task=calendar&month=2&year=100&catid=35&Itemid=1165
• http://fmp.msu.ru/index.php?option=com_k2&view=itemlist&task=calendar&month=2&year=1000&catid=35&Itemid=1165

. Olga Leonidovna Kodolova . Resume . Main publications (ps-file) . Some publications from SLAC HEP database . Activity . Experiment . Some photos . To Hadronic Interactions Laboratory Home Page . Last update: February 15, 1999, ok@alex.npi.msu.su . ALEXEI

Еще в разделе: (Показать все результаты (>39) - lav01.sinp.msu.ru/ )

• Activity of Igor Lokhtin
• Photos related to Igor Lokhtin
• Seminar of Strong Interaction Laboratory

... Research . Research Areas . ... Home News Colloquium on 21.02.08 . ... Information of Ilya Kutsenok about creating an electronic library of laboratory employees' papers . ... Colloquium on 10.04.08 . Colloquium on 24.12.12 20 Dec 2012 . ... Colloquium on 23.11.12 22 Nov 2012 . ... Colloquium on 19.10.12 15 Oct 2012 . Lomonosov Moscow State University . Department of Chemistry . ... Laboratory of Chemical Thermodynamics . ... 2000-2016 Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>7) - td.chem.msu.ru/ )

• Colloquium on 24.02.11 Laboratory of Chemical Thermodynamics
• Colloquium on 26.02.09 Laboratory of Chemical Thermodynamics

... О факультете . ... Master In Ecology . ... Master (MSc) . ... A Master will be able to successfully deal with conceptual issues and practical problems related to various subflields of ecology and environmental science. ... Enables the students to develop biopolicies to deal with ecological problems caused by environmental pollution, the disruption of the ecological matrix of an area, and biodiversity-endangering factors. ... Lectures . ... Д 501.001.20 - все защиты . ... Биологический факультет МГУ ...

Еще в разделе: (Показать все результаты (>3) - www.bio.msu.ru/ )

• Master In Nanobiotechnology ? Биологический факультет МГУ

... Anuran amphibians are known to learn chemical stimuli in embryonic and larval development. Data on "kin recognition" and data on learning of native pond odor are considered as parts of complex chemical imprinting typical for other groups of vertebrates. ... Keywords: amphibians, larval development, chemical imprinting, "kin recognition," native pond odor, sensitive periods. ... We assume that "kin recognition" and learning of native pond odor should be viewed as a complex chemical imprinting. ...

Еще в разделе: (Показать все результаты (>43) - vertebrata.bio.msu.ru/ )

• Student Reports at International Conferences
• Выступления студентов и аспирантов на конференциях

Laboratory of Microfluidics and Nanofluidics . Laboratory of Physical Chemistry of Modified Surfaces . ... Research . ... Laboratory of Micro- and Nanofluidics . ... Professor B.V.Derjaguin moved to the Laboratory with his research group as an Emeritus Professor. ... In 1993 Professor Olga I. Vinogradova took over the leadership of the Laboratory. In 2009 the Laboratory of Micro- and Nanofluidics was organized by Professor Olga I. Vinogradova at the Physics Department of the M.V.Lomonosov MSU. ...

Еще в разделе: (Показать все результаты (>27) - nanofluidics.phys.msu.ru/ )

• Taras Y. Molotilin

Moscow State University Belozersky Institute of Physico-Chemical Biology . Department of Electron Microscopy is a sub-division of A.N. Belozersky Institute of Physico-Chemical Biology . ... We are interested of how eukaryotic cell is organized, formed and functioned. Since A.N. Belozersky Institute of Physico-Chemical Biology is one of the scientific departments of Moscow State University ? ... Understanding the metaphase chromosome architecture remains a basic challenge in cell biology. ...

199. http://mguteam.chat.ru/news1.html

200. Calendar Converter